Incidental Mutation 'R6341:Olfr1448'
ID514426
Institutional Source Beutler Lab
Gene Symbol Olfr1448
Ensembl Gene ENSMUSG00000048456
Gene Nameolfactory receptor 1448
SynonymsMOR202-5, GA_x6K02T2RE5P-3249780-3248836
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6341 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location12916661-12924419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12919479 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 277 (T277A)
Ref Sequence ENSEMBL: ENSMUSP00000149296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054737] [ENSMUST00000213177] [ENSMUST00000213713] [ENSMUST00000216888]
Predicted Effect probably benign
Transcript: ENSMUST00000054737
AA Change: T277A

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000055664
Gene: ENSMUSG00000048456
AA Change: T277A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.2e-54 PFAM
Pfam:7tm_1 39 288 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213177
AA Change: T277A

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000213713
AA Change: T277A

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216888
AA Change: T277A

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Olfr1448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Olfr1448 APN 19 12920126 missense probably damaging 1.00
IGL01730:Olfr1448 APN 19 12919562 missense probably damaging 1.00
IGL01901:Olfr1448 APN 19 12919583 missense probably damaging 0.98
IGL02055:Olfr1448 APN 19 12919566 missense possibly damaging 0.78
R0152:Olfr1448 UTSW 19 12920108 missense possibly damaging 0.49
R0311:Olfr1448 UTSW 19 12920096 missense possibly damaging 0.91
R0349:Olfr1448 UTSW 19 12919935 missense probably damaging 1.00
R1873:Olfr1448 UTSW 19 12919488 missense probably damaging 1.00
R2371:Olfr1448 UTSW 19 12919667 missense probably benign 0.02
R3548:Olfr1448 UTSW 19 12919667 missense probably benign 0.02
R4697:Olfr1448 UTSW 19 12919934 missense probably damaging 0.99
R5482:Olfr1448 UTSW 19 12919905 missense probably damaging 0.96
R5748:Olfr1448 UTSW 19 12920015 missense probably damaging 1.00
R5749:Olfr1448 UTSW 19 12920225 missense probably benign 0.02
R5795:Olfr1448 UTSW 19 12919824 missense possibly damaging 0.95
R5952:Olfr1448 UTSW 19 12919830 missense probably benign 0.00
R6228:Olfr1448 UTSW 19 12919937 missense probably damaging 1.00
R6273:Olfr1448 UTSW 19 12919400 missense probably benign 0.02
R6343:Olfr1448 UTSW 19 12919582 missense probably damaging 1.00
R6454:Olfr1448 UTSW 19 12920031 missense probably benign 0.10
R7666:Olfr1448 UTSW 19 12920162 missense probably damaging 0.99
R7810:Olfr1448 UTSW 19 12919865 missense probably benign 0.01
R7859:Olfr1448 UTSW 19 12919982 missense probably damaging 1.00
R7869:Olfr1448 UTSW 19 12919547 missense probably benign 0.26
R8518:Olfr1448 UTSW 19 12919595 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACAACTCTATGGGATGGTTAGC -3'
(R):5'- TGTAGTCATTACGATCTCCTATCTG -3'

Sequencing Primer
(F):5'- GGCAGATTTTGCATTTCCTA -3'
(R):5'- TGCTTATTTTCATCACTATTCTGAGG -3'
Posted On2018-04-27