Incidental Mutation 'R6348:Ifi213'
ID514429
Institutional Source Beutler Lab
Gene Symbol Ifi213
Ensembl Gene ENSMUSG00000073491
Gene Nameinterferon activated gene 213
SynonymsE030037K03Rik, Pydc4, Pyr-A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6348 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173566283-173599274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 173590282 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 188 (T188I)
Ref Sequence ENSEMBL: ENSMUSP00000117222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097462] [ENSMUST00000150649] [ENSMUST00000180215]
Predicted Effect probably benign
Transcript: ENSMUST00000097462
SMART Domains Protein: ENSMUSP00000095070
Gene: ENSMUSG00000073491

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150649
AA Change: T188I

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117222
Gene: ENSMUSG00000073491
AA Change: T188I

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180215
SMART Domains Protein: ENSMUSP00000136238
Gene: ENSMUSG00000073491

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,414,595 H400Q probably damaging Het
Arhgef16 G T 4: 154,287,083 Q218K probably benign Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atic C T 1: 71,576,698 R468W probably damaging Het
Bfsp2 A T 9: 103,480,072 V52D probably benign Het
Bicd2 A G 13: 49,379,846 H636R probably damaging Het
Chac2 A G 11: 30,977,406 V171A probably damaging Het
Chd9 A G 8: 91,011,275 I1512V possibly damaging Het
Cnbd1 T C 4: 18,860,462 D428G probably damaging Het
Crlf1 T C 8: 70,493,340 S22P probably benign Het
Crybg1 A G 10: 44,003,951 F414L probably damaging Het
Dnah14 A T 1: 181,626,720 D765V possibly damaging Het
Fat3 A G 9: 15,937,991 probably null Het
Gabbr1 A T 17: 37,056,899 M414L possibly damaging Het
Gm960 G C 19: 4,672,078 P105A probably damaging Het
Grip2 A T 6: 91,780,438 D412E probably damaging Het
Herc1 G A 9: 66,487,976 A4198T possibly damaging Het
Hsd3b3 C T 3: 98,755,949 probably null Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kdelc2 G A 9: 53,390,440 V131M probably damaging Het
Klk1b11 T C 7: 43,997,851 probably null Het
Mepce A T 5: 137,785,436 D209E possibly damaging Het
Mtr A C 13: 12,247,954 V111G possibly damaging Het
Olfr1058 T A 2: 86,386,169 Q83L probably benign Het
Olfr826 A T 10: 130,180,297 N194K probably benign Het
Olfr93 A G 17: 37,151,606 V122A probably damaging Het
P2rx1 G A 11: 72,999,322 R3Q probably benign Het
Phc2 G A 4: 128,705,151 G34S probably benign Het
Ppm1a A G 12: 72,790,675 H332R probably benign Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Skiv2l2 T A 13: 112,910,917 H298L possibly damaging Het
Slc2a4 T C 11: 69,945,022 T334A probably benign Het
Slc6a15 T G 10: 103,404,367 V317G probably damaging Het
Speer2 T C 16: 69,858,007 D190G possibly damaging Het
Tbc1d21 G A 9: 58,361,218 A286V probably benign Het
Tmem210 T C 2: 25,288,784 S82P probably benign Het
Zbtb26 C T 2: 37,435,675 V450M probably benign Het
Other mutations in Ifi213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Ifi213 APN 1 173594053 splice site probably benign
IGL00908:Ifi213 APN 1 173595083 missense probably damaging 1.00
IGL00964:Ifi213 APN 1 173593952 missense possibly damaging 0.91
IGL02217:Ifi213 APN 1 173595032 missense possibly damaging 0.91
R0709:Ifi213 UTSW 1 173589800 missense possibly damaging 0.70
R1518:Ifi213 UTSW 1 173589663 missense probably damaging 0.99
R1559:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R1822:Ifi213 UTSW 1 173589842 missense probably damaging 0.99
R1839:Ifi213 UTSW 1 173589600 missense probably damaging 0.98
R1989:Ifi213 UTSW 1 173568808 critical splice donor site probably null
R2108:Ifi213 UTSW 1 173569102 critical splice acceptor site probably null
R2696:Ifi213 UTSW 1 173590024 missense probably benign
R3890:Ifi213 UTSW 1 173567256 missense probably benign 0.33
R4544:Ifi213 UTSW 1 173582127 splice site probably null
R4611:Ifi213 UTSW 1 173589914 missense possibly damaging 0.91
R4689:Ifi213 UTSW 1 173590420 missense possibly damaging 0.92
R4710:Ifi213 UTSW 1 173567172 utr 3 prime probably benign
R5126:Ifi213 UTSW 1 173590015 missense possibly damaging 0.85
R5472:Ifi213 UTSW 1 173567272 splice site probably null
R5625:Ifi213 UTSW 1 173569063 missense possibly damaging 0.73
R5789:Ifi213 UTSW 1 173568794 splice site probably benign
R5898:Ifi213 UTSW 1 173568979 missense probably benign 0.01
R6025:Ifi213 UTSW 1 173595234 missense probably damaging 0.99
R6149:Ifi213 UTSW 1 173594015 missense probably benign 0.18
R6564:Ifi213 UTSW 1 173595296 start codon destroyed probably null 0.06
R7254:Ifi213 UTSW 1 173593963 missense probably damaging 0.98
R7292:Ifi213 UTSW 1 173595125 missense probably damaging 0.99
R7752:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R7901:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R8100:Ifi213 UTSW 1 173595182 missense probably damaging 1.00
RF010:Ifi213 UTSW 1 173582153 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTGAGTCATCTGAGTGGCC -3'
(R):5'- CAGGAAAGCAAAGATACTATCCCTG -3'

Sequencing Primer
(F):5'- AGTCATCTGAGTGGCCTGGAC -3'
(R):5'- TATCCCTGAATCACCTGATACCATG -3'
Posted On2018-04-27