Mutagenetix > Incidental Mutations

Incidental Mutation 'R6348:Dnah14'

514430

Institutional Source

Beutler Lab

Gene Symbol

Dnah14

Ensembl Gene

ENSMUSG00000047369

Gene Name

dynein, axonemal, heavy chain 14

Synonyms

Dnahc14, Gm980, LOC381311, A230079K17Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R6348 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

181576559-181815774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 181626720 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 765 (D765V)

Ref Sequence

ENSEMBL: ENSMUSP00000146843 (fasta)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208001
AA Change: D765V

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox5	A	T	6: 116,414,595	H400Q	probably damaging	Het
Arhgef16	G	T	4: 154,287,083	Q218K	probably benign	Het
Asxl3	A	T	18: 22,517,273	H773L	possibly damaging	Het
Atic	C	T	1: 71,576,698	R468W	probably damaging	Het
Bfsp2	A	T	9: 103,480,072	V52D	probably benign	Het
Bicd2	A	G	13: 49,379,846	H636R	probably damaging	Het
Chac2	A	G	11: 30,977,406	V171A	probably damaging	Het
Chd9	A	G	8: 91,011,275	I1512V	possibly damaging	Het
Cnbd1	T	C	4: 18,860,462	D428G	probably damaging	Het
Crlf1	T	C	8: 70,493,340	S22P	probably benign	Het
Crybg1	A	G	10: 44,003,951	F414L	probably damaging	Het
Fat3	A	G	9: 15,937,991		probably null	Het
Gabbr1	A	T	17: 37,056,899	M414L	possibly damaging	Het
Gm960	G	C	19: 4,672,078	P105A	probably damaging	Het
Grip2	A	T	6: 91,780,438	D412E	probably damaging	Het
Herc1	G	A	9: 66,487,976	A4198T	possibly damaging	Het
Hsd3b3	C	T	3: 98,755,949		probably null	Het
Ifi213	G	A	1: 173,590,282	T188I	possibly damaging	Het
Il1f5	G	A	2: 24,279,714	A29T	probably damaging	Het
Kdelc2	G	A	9: 53,390,440	V131M	probably damaging	Het
Klk1b11	T	C	7: 43,997,851		probably null	Het
Mepce	A	T	5: 137,785,436	D209E	possibly damaging	Het
Mtr	A	C	13: 12,247,954	V111G	possibly damaging	Het
Olfr1058	T	A	2: 86,386,169	Q83L	probably benign	Het
Olfr826	A	T	10: 130,180,297	N194K	probably benign	Het
Olfr93	A	G	17: 37,151,606	V122A	probably damaging	Het
P2rx1	G	A	11: 72,999,322	R3Q	probably benign	Het
Phc2	G	A	4: 128,705,151	G34S	probably benign	Het
Ppm1a	A	G	12: 72,790,675	H332R	probably benign	Het
Sdk2	A	G	11: 113,893,508	V135A	probably benign	Het
Skiv2l2	T	A	13: 112,910,917	H298L	possibly damaging	Het
Slc2a4	T	C	11: 69,945,022	T334A	probably benign	Het
Slc6a15	T	G	10: 103,404,367	V317G	probably damaging	Het
Speer2	T	C	16: 69,858,007	D190G	possibly damaging	Het
Tbc1d21	G	A	9: 58,361,218	A286V	probably benign	Het
Tmem210	T	C	2: 25,288,784	S82P	probably benign	Het
Zbtb26	C	T	2: 37,435,675	V450M	probably benign	Het

Other mutations in Dnah14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Dnah14	APN	1	181752046	missense	probably benign	0.17
IGL01764:Dnah14	APN	1	181744777	missense	probably benign	0.00
IGL03218:Dnah14	APN	1	181755269	missense	probably benign	0.02
IGL03290:Dnah14	APN	1	181763978	splice site	probably benign
IGL03384:Dnah14	APN	1	181745949	missense	probably benign	0.03
R0009:Dnah14	UTSW	1	181769407	splice site	probably benign
R0125:Dnah14	UTSW	1	181752063	missense	probably damaging	0.99
R0579:Dnah14	UTSW	1	181744747	missense	possibly damaging	0.72
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0974:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R1609:Dnah14	UTSW	1	181750177	missense	probably damaging	0.97
R1860:Dnah14	UTSW	1	181763960	missense	probably damaging	1.00
R2050:Dnah14	UTSW	1	181752562	missense	probably damaging	1.00
R2974:Dnah14	UTSW	1	181755241	critical splice acceptor site	probably null
R4715:Dnah14	UTSW	1	181757223	missense	probably damaging	1.00
R5076:Dnah14	UTSW	1	181757234	missense	probably benign	0.01
R5424:Dnah14	UTSW	1	181763310	missense	possibly damaging	0.95
R5808:Dnah14	UTSW	1	181741159	missense	possibly damaging	0.72
R5997:Dnah14	UTSW	1	181770105	missense	probably benign	0.00
R6052:Dnah14	UTSW	1	181666487	missense	possibly damaging	0.50
R6061:Dnah14	UTSW	1	181709051	missense	probably damaging	1.00
R6089:Dnah14	UTSW	1	181750154	missense	probably damaging	1.00
R6092:Dnah14	UTSW	1	181621833	missense	probably benign	0.13
R6145:Dnah14	UTSW	1	181666417	missense	probably benign	0.00
R6163:Dnah14	UTSW	1	181666361	missense	probably benign	0.33
R6246:Dnah14	UTSW	1	181680888	missense	probably benign	0.00
R6302:Dnah14	UTSW	1	181601206	missense	possibly damaging	0.96
R6306:Dnah14	UTSW	1	181585024	frame shift	probably null
R6326:Dnah14	UTSW	1	181783556	missense	probably damaging	1.00
R6367:Dnah14	UTSW	1	181755386	splice site	probably null
R6376:Dnah14	UTSW	1	181605894	missense	possibly damaging	0.79
R6389:Dnah14	UTSW	1	181651202	critical splice donor site	probably null
R6433:Dnah14	UTSW	1	181651657	missense	probably damaging	0.99
R6454:Dnah14	UTSW	1	181783705	missense	probably damaging	1.00
R6476:Dnah14	UTSW	1	181744768	missense	probably benign	0.26
R6523:Dnah14	UTSW	1	181643621	missense	probably benign	0.00
R6529:Dnah14	UTSW	1	181666469	missense	probably damaging	0.98
R6538:Dnah14	UTSW	1	181584985	missense	unknown
R6546:Dnah14	UTSW	1	181738987	missense	probably damaging	1.00
R6752:Dnah14	UTSW	1	181593452	missense	probably benign	0.07
R6762:Dnah14	UTSW	1	181757259	missense	probably damaging	1.00
R6786:Dnah14	UTSW	1	181641405	missense	probably benign	0.21
R6849:Dnah14	UTSW	1	181808945	missense	probably benign	0.00
R6877:Dnah14	UTSW	1	181628432	missense	possibly damaging	0.82
R6912:Dnah14	UTSW	1	181750183	missense	possibly damaging	0.83
R6919:Dnah14	UTSW	1	181585066	missense	probably benign	0.04
R6924:Dnah14	UTSW	1	181627952	missense	probably benign	0.04
R6957:Dnah14	UTSW	1	181785175	missense	possibly damaging	0.92
R6980:Dnah14	UTSW	1	181648230	missense	probably benign	0.00
R7018:Dnah14	UTSW	1	181626944	missense	possibly damaging	0.55
R7046:Dnah14	UTSW	1	181623003	missense	probably benign	0.01
R7058:Dnah14	UTSW	1	181698049	missense	probably benign	0.00
R7068:Dnah14	UTSW	1	181769790	missense	probably benign	0.35
R7115:Dnah14	UTSW	1	181720145	missense	probably damaging	1.00
R7130:Dnah14	UTSW	1	181745958	nonsense	probably null
R7165:Dnah14	UTSW	1	181704535	missense	probably benign	0.00
R7169:Dnah14	UTSW	1	181702365	missense	probably benign	0.00
R7184:Dnah14	UTSW	1	181704529	nonsense	probably null
R7232:Dnah14	UTSW	1	181757363	missense	probably damaging	1.00
R7260:Dnah14	UTSW	1	181706744	missense	probably damaging	0.99
R7276:Dnah14	UTSW	1	181685807	missense	probably benign	0.41
R7290:Dnah14	UTSW	1	181628174	missense	probably benign	0.20
R7314:Dnah14	UTSW	1	181785254	splice site	probably null
R7326:Dnah14	UTSW	1	181598403	missense	probably benign	0.02
R7336:Dnah14	UTSW	1	181797734	missense	probably damaging	0.96
R7363:Dnah14	UTSW	1	181690524	splice site	probably null
R7371:Dnah14	UTSW	1	181626885	missense	probably benign	0.05
R7376:Dnah14	UTSW	1	181763402	missense	probably benign	0.03
R7418:Dnah14	UTSW	1	181616742	missense	possibly damaging	0.92
R7473:Dnah14	UTSW	1	181752139	missense	probably damaging	0.99
R7514:Dnah14	UTSW	1	181628067	missense	probably damaging	0.96
R7555:Dnah14	UTSW	1	181770054	missense	probably benign	0.26
R7641:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7663:Dnah14	UTSW	1	181752155	splice site	probably null
R7674:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7680:Dnah14	UTSW	1	181685800	missense	probably benign	0.15
R7709:Dnah14	UTSW	1	181702484	critical splice donor site	probably null
R7842:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
R7861:Dnah14	UTSW	1	181616759	missense	probably damaging	1.00
R7988:Dnah14	UTSW	1	181783574	missense	probably damaging	0.97
R8016:Dnah14	UTSW	1	181648311	missense	probably benign	0.05
R8042:Dnah14	UTSW	1	181643631	critical splice donor site	probably null
R8071:Dnah14	UTSW	1	181615894	missense	possibly damaging	0.84
R8086:Dnah14	UTSW	1	181766232	missense	probably damaging	1.00
R8095:Dnah14	UTSW	1	181806032	nonsense	probably null
R8139:Dnah14	UTSW	1	181755288	missense	probably damaging	1.00
R8176:Dnah14	UTSW	1	181657033	missense	probably damaging	0.96
R8193:Dnah14	UTSW	1	181688205	missense	probably damaging	1.00
R8197:Dnah14	UTSW	1	181690101	missense	possibly damaging	0.94
R8209:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8226:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8251:Dnah14	UTSW	1	181664865	missense	probably damaging	1.00
R8264:Dnah14	UTSW	1	181744792	missense	probably damaging	0.99
R8284:Dnah14	UTSW	1	181773811	missense	probably benign	0.03
R8289:Dnah14	UTSW	1	181716215	nonsense	probably null
R8323:Dnah14	UTSW	1	181704544	missense	probably benign	0.01
R8442:Dnah14	UTSW	1	181741284	missense	probably damaging	0.97
R8458:Dnah14	UTSW	1	181806012	missense
R8507:Dnah14	UTSW	1	181641414	missense	probably benign	0.02
R8509:Dnah14	UTSW	1	181814655	missense
R8520:Dnah14	UTSW	1	181653638	missense	probably damaging	1.00
R8530:Dnah14	UTSW	1	181664946	missense	probably damaging	1.00
R8703:Dnah14	UTSW	1	181666011	nonsense	probably null
R8710:Dnah14	UTSW	1	181690311	missense	probably benign	0.04
R8752:Dnah14	UTSW	1	181628016	missense	probably benign	0.00
R8792:Dnah14	UTSW	1	181814624	missense
R8797:Dnah14	UTSW	1	181637847	missense	probably benign	0.19
R8821:Dnah14	UTSW	1	181792004	nonsense	probably null
RF007:Dnah14	UTSW	1	181685809	missense	probably benign	0.00
RF012:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
Z1176:Dnah14	UTSW	1	181757351	missense	possibly damaging	0.83
Z1177:Dnah14	UTSW	1	181690320	missense	probably benign	0.03
Z1177:Dnah14	UTSW	1	181763334	missense	probably damaging	1.00
Z1177:Dnah14	UTSW	1	181766304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACTTGTAGACGTCAGCC -3'
(R):5'- GACAATATATGCTTCCAAACCGTTC -3'

Sequencing Primer
(F):5'- CTTCTGAAATGAAGAGAGTGGTTTCC -3'
(R):5'- AGACTGGTTTCTCTATTCATGGCGAC -3'

Posted On

2018-04-27