Incidental Mutation 'R6348:Il1f5'
ID514431
Institutional Source Beutler Lab
Gene Symbol Il1f5
Ensembl Gene ENSMUSG00000026983
Gene Nameinterleukin 1 family, member 5 (delta)
SynonymsFIL1delta, IL-1H3, IL1HY1, IL1F5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6348 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location24276954-24283426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24279714 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 29 (A29T)
Ref Sequence ENSEMBL: ENSMUSP00000126028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028360] [ENSMUST00000114490] [ENSMUST00000123053] [ENSMUST00000147885] [ENSMUST00000168941]
Predicted Effect probably damaging
Transcript: ENSMUST00000028360
AA Change: A29T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028360
Gene: ENSMUSG00000026983
AA Change: A29T

DomainStartEndE-ValueType
IL1 5 153 7.96e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114490
AA Change: A29T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110134
Gene: ENSMUSG00000026983
AA Change: A29T

DomainStartEndE-ValueType
IL1 5 153 7.96e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123053
AA Change: A29T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116122
Gene: ENSMUSG00000026983
AA Change: A29T

DomainStartEndE-ValueType
PDB:1MD6|A 3 72 5e-45 PDB
Blast:IL1 5 72 1e-42 BLAST
SCOP:d1ilr1_ 10 71 1e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123577
Predicted Effect probably damaging
Transcript: ENSMUST00000147885
AA Change: A29T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141512
Gene: ENSMUSG00000026983
AA Change: A29T

DomainStartEndE-ValueType
PDB:1MD6|A 3 82 2e-52 PDB
Blast:IL1 5 82 3e-50 BLAST
SCOP:d1ilr1_ 10 82 2e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168941
AA Change: A29T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126028
Gene: ENSMUSG00000026983
AA Change: A29T

DomainStartEndE-ValueType
IL1 5 153 7.96e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195464
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine was shown to specifically inhibit the activation of NF-kappaB induced by interleukin 1 family, member 6 (IL1F6). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are overtly normal with no apparent histopathological abnormalities or immune cell alterations. Mice homozygous for a knock-out allele exhibit increased sensitivity to IMQ-induced psoriasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,414,595 H400Q probably damaging Het
Arhgef16 G T 4: 154,287,083 Q218K probably benign Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atic C T 1: 71,576,698 R468W probably damaging Het
Bfsp2 A T 9: 103,480,072 V52D probably benign Het
Bicd2 A G 13: 49,379,846 H636R probably damaging Het
Chac2 A G 11: 30,977,406 V171A probably damaging Het
Chd9 A G 8: 91,011,275 I1512V possibly damaging Het
Cnbd1 T C 4: 18,860,462 D428G probably damaging Het
Crlf1 T C 8: 70,493,340 S22P probably benign Het
Crybg1 A G 10: 44,003,951 F414L probably damaging Het
Dnah14 A T 1: 181,626,720 D765V possibly damaging Het
Fat3 A G 9: 15,937,991 probably null Het
Gabbr1 A T 17: 37,056,899 M414L possibly damaging Het
Gm960 G C 19: 4,672,078 P105A probably damaging Het
Grip2 A T 6: 91,780,438 D412E probably damaging Het
Herc1 G A 9: 66,487,976 A4198T possibly damaging Het
Hsd3b3 C T 3: 98,755,949 probably null Het
Ifi213 G A 1: 173,590,282 T188I possibly damaging Het
Kdelc2 G A 9: 53,390,440 V131M probably damaging Het
Klk1b11 T C 7: 43,997,851 probably null Het
Mepce A T 5: 137,785,436 D209E possibly damaging Het
Mtr A C 13: 12,247,954 V111G possibly damaging Het
Olfr1058 T A 2: 86,386,169 Q83L probably benign Het
Olfr826 A T 10: 130,180,297 N194K probably benign Het
Olfr93 A G 17: 37,151,606 V122A probably damaging Het
P2rx1 G A 11: 72,999,322 R3Q probably benign Het
Phc2 G A 4: 128,705,151 G34S probably benign Het
Ppm1a A G 12: 72,790,675 H332R probably benign Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Skiv2l2 T A 13: 112,910,917 H298L possibly damaging Het
Slc2a4 T C 11: 69,945,022 T334A probably benign Het
Slc6a15 T G 10: 103,404,367 V317G probably damaging Het
Speer2 T C 16: 69,858,007 D190G possibly damaging Het
Tbc1d21 G A 9: 58,361,218 A286V probably benign Het
Tmem210 T C 2: 25,288,784 S82P probably benign Het
Zbtb26 C T 2: 37,435,675 V450M probably benign Het
Other mutations in Il1f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2004:Il1f5 UTSW 2 24281364 missense probably damaging 1.00
R2162:Il1f5 UTSW 2 24279680 missense probably damaging 0.98
R2190:Il1f5 UTSW 2 24280819 missense probably damaging 1.00
R3737:Il1f5 UTSW 2 24281203 missense probably damaging 1.00
R4740:Il1f5 UTSW 2 24277491 utr 5 prime probably benign
R4867:Il1f5 UTSW 2 24280835 missense probably damaging 1.00
R5908:Il1f5 UTSW 2 24277490 start gained probably benign
R6218:Il1f5 UTSW 2 24277490 start gained probably benign
R6347:Il1f5 UTSW 2 24279714 missense probably damaging 1.00
R6407:Il1f5 UTSW 2 24281353 missense probably damaging 1.00
R7067:Il1f5 UTSW 2 24277529 nonsense probably null
R7403:Il1f5 UTSW 2 24281202 missense probably damaging 1.00
R7477:Il1f5 UTSW 2 24279692 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAAAAGTTGCATGACTGTGTC -3'
(R):5'- CTACACAGAGGCTGCATTGG -3'

Sequencing Primer
(F):5'- AAAGTTGCATGACTGTGTCTGTCAC -3'
(R):5'- GGGTCTACACTTTGTTTAAAGCC -3'
Posted On2018-04-27