Incidental Mutation 'R6348:Zbtb26'
ID514433
Institutional Source Beutler Lab
Gene Symbol Zbtb26
Ensembl Gene ENSMUSG00000050714
Gene Namezinc finger and BTB domain containing 26
SynonymsA630026F21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R6348 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37432168-37443135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37435675 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 450 (V450M)
Ref Sequence ENSEMBL: ENSMUSP00000099850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053098] [ENSMUST00000067043] [ENSMUST00000102789] [ENSMUST00000112932]
Predicted Effect probably benign
Transcript: ENSMUST00000053098
SMART Domains Protein: ENSMUSP00000056100
Gene: ENSMUSG00000066798

DomainStartEndE-ValueType
BTB 33 127 2.67e-16 SMART
Blast:BTB 161 196 1e-5 BLAST
ZnF_C2H2 300 322 7.15e-2 SMART
ZnF_C2H2 325 347 1.58e-3 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
ZnF_C2H2 381 404 8.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067043
AA Change: V439M

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070071
Gene: ENSMUSG00000050714
AA Change: V439M

DomainStartEndE-ValueType
BTB 33 127 4.38e-12 SMART
low complexity region 169 179 N/A INTRINSIC
ZnF_C2H2 273 295 1.36e-2 SMART
ZnF_C2H2 298 320 1.4e-4 SMART
ZnF_C2H2 326 348 2.99e-4 SMART
ZnF_C2H2 354 377 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102789
AA Change: V450M

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099850
Gene: ENSMUSG00000050714
AA Change: V450M

DomainStartEndE-ValueType
BTB 44 138 4.38e-12 SMART
low complexity region 180 190 N/A INTRINSIC
ZnF_C2H2 284 306 1.36e-2 SMART
ZnF_C2H2 309 331 1.4e-4 SMART
ZnF_C2H2 337 359 2.99e-4 SMART
ZnF_C2H2 365 388 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112932
SMART Domains Protein: ENSMUSP00000108554
Gene: ENSMUSG00000066798

DomainStartEndE-ValueType
BTB 33 127 2.67e-16 SMART
Blast:BTB 161 196 1e-5 BLAST
ZnF_C2H2 300 322 7.15e-2 SMART
ZnF_C2H2 325 347 1.58e-3 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
ZnF_C2H2 381 404 8.81e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203522
Meta Mutation Damage Score 0.1399 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,414,595 H400Q probably damaging Het
Arhgef16 G T 4: 154,287,083 Q218K probably benign Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atic C T 1: 71,576,698 R468W probably damaging Het
Bfsp2 A T 9: 103,480,072 V52D probably benign Het
Bicd2 A G 13: 49,379,846 H636R probably damaging Het
Chac2 A G 11: 30,977,406 V171A probably damaging Het
Chd9 A G 8: 91,011,275 I1512V possibly damaging Het
Cnbd1 T C 4: 18,860,462 D428G probably damaging Het
Crlf1 T C 8: 70,493,340 S22P probably benign Het
Crybg1 A G 10: 44,003,951 F414L probably damaging Het
Dnah14 A T 1: 181,626,720 D765V possibly damaging Het
Fat3 A G 9: 15,937,991 probably null Het
Gabbr1 A T 17: 37,056,899 M414L possibly damaging Het
Gm960 G C 19: 4,672,078 P105A probably damaging Het
Grip2 A T 6: 91,780,438 D412E probably damaging Het
Herc1 G A 9: 66,487,976 A4198T possibly damaging Het
Hsd3b3 C T 3: 98,755,949 probably null Het
Ifi213 G A 1: 173,590,282 T188I possibly damaging Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kdelc2 G A 9: 53,390,440 V131M probably damaging Het
Klk1b11 T C 7: 43,997,851 probably null Het
Mepce A T 5: 137,785,436 D209E possibly damaging Het
Mtr A C 13: 12,247,954 V111G possibly damaging Het
Olfr1058 T A 2: 86,386,169 Q83L probably benign Het
Olfr826 A T 10: 130,180,297 N194K probably benign Het
Olfr93 A G 17: 37,151,606 V122A probably damaging Het
P2rx1 G A 11: 72,999,322 R3Q probably benign Het
Phc2 G A 4: 128,705,151 G34S probably benign Het
Ppm1a A G 12: 72,790,675 H332R probably benign Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Skiv2l2 T A 13: 112,910,917 H298L possibly damaging Het
Slc2a4 T C 11: 69,945,022 T334A probably benign Het
Slc6a15 T G 10: 103,404,367 V317G probably damaging Het
Speer2 T C 16: 69,858,007 D190G possibly damaging Het
Tbc1d21 G A 9: 58,361,218 A286V probably benign Het
Tmem210 T C 2: 25,288,784 S82P probably benign Het
Other mutations in Zbtb26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Zbtb26 APN 2 37436442 missense possibly damaging 0.82
IGL00899:Zbtb26 APN 2 37436258 nonsense probably null
IGL01598:Zbtb26 APN 2 37436271 missense probably damaging 1.00
IGL01940:Zbtb26 APN 2 37435975 missense possibly damaging 0.93
IGL02152:Zbtb26 APN 2 37436691 missense possibly damaging 0.95
IGL02867:Zbtb26 APN 2 37436249 missense probably benign 0.00
IGL02889:Zbtb26 APN 2 37436249 missense probably benign 0.00
IGL03081:Zbtb26 APN 2 37436600 missense possibly damaging 0.67
R0138:Zbtb26 UTSW 2 37436041 missense probably benign 0.16
R0328:Zbtb26 UTSW 2 37436795 missense possibly damaging 0.81
R0927:Zbtb26 UTSW 2 37436325 missense possibly damaging 0.91
R1671:Zbtb26 UTSW 2 37436365 missense probably benign 0.00
R1813:Zbtb26 UTSW 2 37436335 missense possibly damaging 0.68
R1896:Zbtb26 UTSW 2 37436335 missense possibly damaging 0.68
R2128:Zbtb26 UTSW 2 37436551 missense probably benign 0.00
R2374:Zbtb26 UTSW 2 37436485 missense probably benign
R4050:Zbtb26 UTSW 2 37436988 start codon destroyed probably null 0.46
R4631:Zbtb26 UTSW 2 37436956 missense probably benign 0.00
R4940:Zbtb26 UTSW 2 37436769 missense probably damaging 0.98
R5071:Zbtb26 UTSW 2 37435929 missense probably benign 0.26
R6962:Zbtb26 UTSW 2 37436094 missense possibly damaging 0.71
R6990:Zbtb26 UTSW 2 37436545 missense probably benign 0.00
R7261:Zbtb26 UTSW 2 37436655 missense possibly damaging 0.71
R8013:Zbtb26 UTSW 2 37437001 critical splice acceptor site probably null
R8014:Zbtb26 UTSW 2 37437001 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTACCTTCAGAATGTGCTTGG -3'
(R):5'- CACCTTAAACAGCTGCATGGC -3'

Sequencing Primer
(F):5'- GTGCCAGTCTAAGACATATATCAAC -3'
(R):5'- CTGCATGGCAAAAACAGCTTTG -3'
Posted On2018-04-27