Incidental Mutation 'R6348:Olfr1058'
ID514434
Institutional Source Beutler Lab
Gene Symbol Olfr1058
Ensembl Gene ENSMUSG00000075186
Gene Nameolfactory receptor 1058
SynonymsGA_x6K02T2Q125-47855818-47854868, MOR190-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R6348 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86384760-86388561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86386169 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 83 (Q83L)
Ref Sequence ENSEMBL: ENSMUSP00000151037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102631] [ENSMUST00000213998]
Predicted Effect probably benign
Transcript: ENSMUST00000102631
AA Change: Q83L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099691
Gene: ENSMUSG00000075186
AA Change: Q83L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-49 PFAM
Pfam:7tm_1 41 290 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213998
AA Change: Q83L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215214
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,414,595 H400Q probably damaging Het
Arhgef16 G T 4: 154,287,083 Q218K probably benign Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atic C T 1: 71,576,698 R468W probably damaging Het
Bfsp2 A T 9: 103,480,072 V52D probably benign Het
Bicd2 A G 13: 49,379,846 H636R probably damaging Het
Chac2 A G 11: 30,977,406 V171A probably damaging Het
Chd9 A G 8: 91,011,275 I1512V possibly damaging Het
Cnbd1 T C 4: 18,860,462 D428G probably damaging Het
Crlf1 T C 8: 70,493,340 S22P probably benign Het
Crybg1 A G 10: 44,003,951 F414L probably damaging Het
Dnah14 A T 1: 181,626,720 D765V possibly damaging Het
Fat3 A G 9: 15,937,991 probably null Het
Gabbr1 A T 17: 37,056,899 M414L possibly damaging Het
Gm960 G C 19: 4,672,078 P105A probably damaging Het
Grip2 A T 6: 91,780,438 D412E probably damaging Het
Herc1 G A 9: 66,487,976 A4198T possibly damaging Het
Hsd3b3 C T 3: 98,755,949 probably null Het
Ifi213 G A 1: 173,590,282 T188I possibly damaging Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kdelc2 G A 9: 53,390,440 V131M probably damaging Het
Klk1b11 T C 7: 43,997,851 probably null Het
Mepce A T 5: 137,785,436 D209E possibly damaging Het
Mtr A C 13: 12,247,954 V111G possibly damaging Het
Olfr826 A T 10: 130,180,297 N194K probably benign Het
Olfr93 A G 17: 37,151,606 V122A probably damaging Het
P2rx1 G A 11: 72,999,322 R3Q probably benign Het
Phc2 G A 4: 128,705,151 G34S probably benign Het
Ppm1a A G 12: 72,790,675 H332R probably benign Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Skiv2l2 T A 13: 112,910,917 H298L possibly damaging Het
Slc2a4 T C 11: 69,945,022 T334A probably benign Het
Slc6a15 T G 10: 103,404,367 V317G probably damaging Het
Speer2 T C 16: 69,858,007 D190G possibly damaging Het
Tbc1d21 G A 9: 58,361,218 A286V probably benign Het
Tmem210 T C 2: 25,288,784 S82P probably benign Het
Zbtb26 C T 2: 37,435,675 V450M probably benign Het
Other mutations in Olfr1058
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Olfr1058 APN 2 86386021 nonsense probably null
R0413:Olfr1058 UTSW 2 86385714 missense probably benign 0.02
R1315:Olfr1058 UTSW 2 86386174 missense possibly damaging 0.86
R1609:Olfr1058 UTSW 2 86385494 missense probably benign 0.07
R1951:Olfr1058 UTSW 2 86385511 missense probably benign 0.03
R2184:Olfr1058 UTSW 2 86386145 missense probably benign 0.05
R2351:Olfr1058 UTSW 2 86386127 missense probably damaging 0.99
R4067:Olfr1058 UTSW 2 86386087 nonsense probably null
R4706:Olfr1058 UTSW 2 86386388 missense probably benign 0.29
R5164:Olfr1058 UTSW 2 86385471 missense probably benign
R5224:Olfr1058 UTSW 2 86385849 missense possibly damaging 0.91
R5254:Olfr1058 UTSW 2 86386140 missense possibly damaging 0.65
R5424:Olfr1058 UTSW 2 86385840 nonsense probably null
R5907:Olfr1058 UTSW 2 86385874 missense probably damaging 0.97
R5980:Olfr1058 UTSW 2 86385797 nonsense probably null
R6874:Olfr1058 UTSW 2 86385528 missense possibly damaging 0.95
R6897:Olfr1058 UTSW 2 86385680 missense possibly damaging 0.91
R7060:Olfr1058 UTSW 2 86386225 missense possibly damaging 0.95
R7516:Olfr1058 UTSW 2 86385984 missense probably benign 0.35
R7530:Olfr1058 UTSW 2 86386171 missense probably damaging 1.00
R8130:Olfr1058 UTSW 2 86385567 missense probably benign 0.14
Z1088:Olfr1058 UTSW 2 86385756 missense probably benign 0.43
Z1088:Olfr1058 UTSW 2 86386179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAGCCACAATTGTACAGTAGAC -3'
(R):5'- GAACTGCAGCCTCCATTATTTG -3'

Sequencing Primer
(F):5'- GCACCAAGCATAGTCTTTTTGAC -3'
(R):5'- GCAGCCTCCATTATTTGTACTTTTC -3'
Posted On2018-04-27