Incidental Mutation 'R6348:Mepce'
ID514438
Institutional Source Beutler Lab
Gene Symbol Mepce
Ensembl Gene ENSMUSG00000029726
Gene Namemethylphosphate capping enzyme
SynonymsBcdin3, D5Wsu46e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6348 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location137781906-137787655 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137785436 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 209 (D209E)
Ref Sequence ENSEMBL: ENSMUSP00000031740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031740] [ENSMUST00000035852] [ENSMUST00000196022]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031740
AA Change: D209E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031740
Gene: ENSMUSG00000029726
AA Change: D209E

DomainStartEndE-ValueType
low complexity region 14 19 N/A INTRINSIC
low complexity region 49 74 N/A INTRINSIC
low complexity region 115 121 N/A INTRINSIC
low complexity region 130 136 N/A INTRINSIC
low complexity region 234 254 N/A INTRINSIC
low complexity region 307 352 N/A INTRINSIC
low complexity region 355 376 N/A INTRINSIC
Pfam:Methyltransf_23 398 623 2.7e-14 PFAM
Pfam:PrmA 408 489 6.9e-6 PFAM
Pfam:Methyltransf_31 419 480 9.3e-9 PFAM
Pfam:Methyltransf_18 420 595 1.8e-13 PFAM
Pfam:Bin3 552 660 4.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035852
SMART Domains Protein: ENSMUSP00000048730
Gene: ENSMUSG00000037108

DomainStartEndE-ValueType
Pfam:zf-CW 246 293 7.3e-18 PFAM
Pfam:PWWP 306 401 6.9e-22 PFAM
coiled coil region 440 462 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132726
SMART Domains Protein: ENSMUSP00000118688
Gene: ENSMUSG00000029726

DomainStartEndE-ValueType
Pfam:Methyltransf_11 33 99 8e-6 PFAM
Pfam:Bin3 59 167 8.3e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140336
Predicted Effect probably benign
Transcript: ENSMUST00000196022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196936
Meta Mutation Damage Score 0.1461 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,414,595 H400Q probably damaging Het
Arhgef16 G T 4: 154,287,083 Q218K probably benign Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atic C T 1: 71,576,698 R468W probably damaging Het
Bfsp2 A T 9: 103,480,072 V52D probably benign Het
Bicd2 A G 13: 49,379,846 H636R probably damaging Het
Chac2 A G 11: 30,977,406 V171A probably damaging Het
Chd9 A G 8: 91,011,275 I1512V possibly damaging Het
Cnbd1 T C 4: 18,860,462 D428G probably damaging Het
Crlf1 T C 8: 70,493,340 S22P probably benign Het
Crybg1 A G 10: 44,003,951 F414L probably damaging Het
Dnah14 A T 1: 181,626,720 D765V possibly damaging Het
Fat3 A G 9: 15,937,991 probably null Het
Gabbr1 A T 17: 37,056,899 M414L possibly damaging Het
Gm960 G C 19: 4,672,078 P105A probably damaging Het
Grip2 A T 6: 91,780,438 D412E probably damaging Het
Herc1 G A 9: 66,487,976 A4198T possibly damaging Het
Hsd3b3 C T 3: 98,755,949 probably null Het
Ifi213 G A 1: 173,590,282 T188I possibly damaging Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kdelc2 G A 9: 53,390,440 V131M probably damaging Het
Klk1b11 T C 7: 43,997,851 probably null Het
Mtr A C 13: 12,247,954 V111G possibly damaging Het
Olfr1058 T A 2: 86,386,169 Q83L probably benign Het
Olfr826 A T 10: 130,180,297 N194K probably benign Het
Olfr93 A G 17: 37,151,606 V122A probably damaging Het
P2rx1 G A 11: 72,999,322 R3Q probably benign Het
Phc2 G A 4: 128,705,151 G34S probably benign Het
Ppm1a A G 12: 72,790,675 H332R probably benign Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Skiv2l2 T A 13: 112,910,917 H298L possibly damaging Het
Slc2a4 T C 11: 69,945,022 T334A probably benign Het
Slc6a15 T G 10: 103,404,367 V317G probably damaging Het
Speer2 T C 16: 69,858,007 D190G possibly damaging Het
Tbc1d21 G A 9: 58,361,218 A286V probably benign Het
Tmem210 T C 2: 25,288,784 S82P probably benign Het
Zbtb26 C T 2: 37,435,675 V450M probably benign Het
Other mutations in Mepce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02205:Mepce APN 5 137784495 missense probably benign 0.14
R0254:Mepce UTSW 5 137785436 missense possibly damaging 0.70
R0772:Mepce UTSW 5 137785312 intron probably benign
R1081:Mepce UTSW 5 137784696 missense probably damaging 1.00
R4588:Mepce UTSW 5 137785272 missense possibly damaging 0.86
R4671:Mepce UTSW 5 137786643 intron probably benign
R4879:Mepce UTSW 5 137785282 intron probably benign
R5315:Mepce UTSW 5 137782693 missense probably damaging 1.00
R5334:Mepce UTSW 5 137786627 missense probably benign 0.00
R5341:Mepce UTSW 5 137783260 missense probably damaging 0.98
R5905:Mepce UTSW 5 137784720 missense possibly damaging 0.78
R6339:Mepce UTSW 5 137785688 missense possibly damaging 0.72
R6630:Mepce UTSW 5 137784921 missense probably benign 0.01
R7056:Mepce UTSW 5 137782706 missense probably damaging 1.00
R8054:Mepce UTSW 5 137784742 nonsense probably null
R8152:Mepce UTSW 5 137784673 missense probably benign 0.03
Z1176:Mepce UTSW 5 137785842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATAGGGTTGAGGGGCATC -3'
(R):5'- GCGACTCTGTGTTACCATCC -3'

Sequencing Primer
(F):5'- TGAGGGGCATCACGGTTC -3'
(R):5'- ATCCAATTTCCTTCTGGGGG -3'
Posted On2018-04-27