Incidental Mutation 'R6348:Klk1b11'
ID514441
Institutional Source Beutler Lab
Gene Symbol Klk1b11
Ensembl Gene ENSMUSG00000044485
Gene Namekallikrein 1-related peptidase b11
SynonymsKlk11, mGK-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6348 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43995877-43999875 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 43997851 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000007156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007156] [ENSMUST00000007156] [ENSMUST00000007156]
Predicted Effect probably null
Transcript: ENSMUST00000007156
SMART Domains Protein: ENSMUSP00000007156
Gene: ENSMUSG00000044485

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 6.47e-101 SMART
Predicted Effect probably null
Transcript: ENSMUST00000007156
SMART Domains Protein: ENSMUSP00000007156
Gene: ENSMUSG00000044485

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 6.47e-101 SMART
Predicted Effect probably null
Transcript: ENSMUST00000007156
SMART Domains Protein: ENSMUSP00000007156
Gene: ENSMUSG00000044485

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 6.47e-101 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206787
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,414,595 H400Q probably damaging Het
Arhgef16 G T 4: 154,287,083 Q218K probably benign Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atic C T 1: 71,576,698 R468W probably damaging Het
Bfsp2 A T 9: 103,480,072 V52D probably benign Het
Bicd2 A G 13: 49,379,846 H636R probably damaging Het
Chac2 A G 11: 30,977,406 V171A probably damaging Het
Chd9 A G 8: 91,011,275 I1512V possibly damaging Het
Cnbd1 T C 4: 18,860,462 D428G probably damaging Het
Crlf1 T C 8: 70,493,340 S22P probably benign Het
Crybg1 A G 10: 44,003,951 F414L probably damaging Het
Dnah14 A T 1: 181,626,720 D765V possibly damaging Het
Fat3 A G 9: 15,937,991 probably null Het
Gabbr1 A T 17: 37,056,899 M414L possibly damaging Het
Gm960 G C 19: 4,672,078 P105A probably damaging Het
Grip2 A T 6: 91,780,438 D412E probably damaging Het
Herc1 G A 9: 66,487,976 A4198T possibly damaging Het
Hsd3b3 C T 3: 98,755,949 probably null Het
Ifi213 G A 1: 173,590,282 T188I possibly damaging Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kdelc2 G A 9: 53,390,440 V131M probably damaging Het
Mepce A T 5: 137,785,436 D209E possibly damaging Het
Mtr A C 13: 12,247,954 V111G possibly damaging Het
Olfr1058 T A 2: 86,386,169 Q83L probably benign Het
Olfr826 A T 10: 130,180,297 N194K probably benign Het
Olfr93 A G 17: 37,151,606 V122A probably damaging Het
P2rx1 G A 11: 72,999,322 R3Q probably benign Het
Phc2 G A 4: 128,705,151 G34S probably benign Het
Ppm1a A G 12: 72,790,675 H332R probably benign Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Skiv2l2 T A 13: 112,910,917 H298L possibly damaging Het
Slc2a4 T C 11: 69,945,022 T334A probably benign Het
Slc6a15 T G 10: 103,404,367 V317G probably damaging Het
Speer2 T C 16: 69,858,007 D190G possibly damaging Het
Tbc1d21 G A 9: 58,361,218 A286V probably benign Het
Tmem210 T C 2: 25,288,784 S82P probably benign Het
Zbtb26 C T 2: 37,435,675 V450M probably benign Het
Other mutations in Klk1b11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Klk1b11 APN 7 43999819 missense probably damaging 1.00
IGL01501:Klk1b11 APN 7 43999834 utr 3 prime probably benign
IGL02054:Klk1b11 APN 7 43998827 missense possibly damaging 0.90
IGL02267:Klk1b11 APN 7 43999741 missense probably damaging 1.00
R0125:Klk1b11 UTSW 7 43999051 missense probably benign 0.10
R0449:Klk1b11 UTSW 7 43997792 missense probably damaging 1.00
R0708:Klk1b11 UTSW 7 43997728 missense possibly damaging 0.59
R4361:Klk1b11 UTSW 7 43995954 splice site probably null
R4452:Klk1b11 UTSW 7 43995911 missense probably damaging 0.96
R5120:Klk1b11 UTSW 7 43999022 missense probably benign 0.29
R5214:Klk1b11 UTSW 7 43997842 missense probably benign 0.02
R5219:Klk1b11 UTSW 7 43999696 missense probably damaging 1.00
R6803:Klk1b11 UTSW 7 43997837 missense probably damaging 1.00
R7065:Klk1b11 UTSW 7 43998962 missense probably benign 0.22
R7172:Klk1b11 UTSW 7 43999247 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCTCCTGTTGCAGATGCTG -3'
(R):5'- AGAAAGGTGTGCCTAGTGTCC -3'

Sequencing Primer
(F):5'- CAGATGCTGCACCTCCTG -3'
(R):5'- TGCCTAGTGTCCCAAGTCAGAC -3'
Posted On2018-04-27