Mutagenetix > Incidental Mutation

Incidental Mutation 'R6348:Chd9'

514443

Institutional Source

Beutler Lab

Gene Symbol

Chd9

Ensembl Gene

ENSMUSG00000056608

Gene Name

chromodomain helicase DNA binding protein 9

Synonyms

1810014J18Rik, AD013, 9030205D12Rik, A330063D19Rik

MMRRC Submission

044502-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6348 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90828352-91054516 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91011275 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1512 (I1512V)

Ref Sequence

ENSEMBL: ENSMUSP00000147407 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423] [ENSMUST00000210947]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000048665
AA Change: I1512V

SMART Domains

Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: I1512V

Domain	Start	End	E-Value	Type
low complexity region	323	334	N/A	INTRINSIC
low complexity region	586	605	N/A	INTRINSIC
CHROMO	687	753	2.41e-10	SMART
CHROMO	770	828	4.35e-8	SMART
DEXDc	855	1056	3.8e-36	SMART
Blast:DEXDc	1149	1174	7e-6	BLAST
HELICc	1211	1295	2.86e-22	SMART
low complexity region	1462	1475	N/A	INTRINSIC
Blast:DEXDc	1506	1551	3e-16	BLAST
low complexity region	2048	2067	N/A	INTRINSIC
low complexity region	2127	2199	N/A	INTRINSIC
BRK	2456	2505	6.77e-25	SMART
BRK	2530	2574	1.5e-17	SMART
low complexity region	2594	2608	N/A	INTRINSIC
low complexity region	2609	2639	N/A	INTRINSIC
low complexity region	2642	2659	N/A	INTRINSIC
low complexity region	2690	2704	N/A	INTRINSIC
low complexity region	2746	2771	N/A	INTRINSIC
low complexity region	2802	2813	N/A	INTRINSIC
low complexity region	2843	2869	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000109614
AA Change: I1512V

SMART Domains

Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: I1512V

Domain	Start	End	E-Value	Type
low complexity region	323	334	N/A	INTRINSIC
low complexity region	586	605	N/A	INTRINSIC
CHROMO	687	753	2.41e-10	SMART
CHROMO	770	828	4.35e-8	SMART
DEXDc	855	1056	3.8e-36	SMART
Blast:DEXDc	1149	1174	7e-6	BLAST
HELICc	1211	1295	2.86e-22	SMART
low complexity region	1462	1475	N/A	INTRINSIC
Blast:DEXDc	1506	1551	3e-16	BLAST
low complexity region	2048	2067	N/A	INTRINSIC
low complexity region	2127	2199	N/A	INTRINSIC
BRK	2472	2521	6.77e-25	SMART
BRK	2546	2590	1.5e-17	SMART
low complexity region	2610	2624	N/A	INTRINSIC
low complexity region	2625	2655	N/A	INTRINSIC
low complexity region	2658	2675	N/A	INTRINSIC
low complexity region	2706	2720	N/A	INTRINSIC
low complexity region	2762	2787	N/A	INTRINSIC
low complexity region	2818	2829	N/A	INTRINSIC
low complexity region	2859	2885	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209203
AA Change: I1512V

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

unknown
Transcript: ENSMUST00000209423
AA Change: I1512V

Predicted Effect

probably benign
Transcript: ENSMUST00000210947

Meta Mutation Damage Score

0.1757

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox5	A	T	6: 116,414,595	H400Q	probably damaging	Het
Arhgef16	G	T	4: 154,287,083	Q218K	probably benign	Het
Asxl3	A	T	18: 22,517,273	H773L	possibly damaging	Het
Atic	C	T	1: 71,576,698	R468W	probably damaging	Het
Bfsp2	A	T	9: 103,480,072	V52D	probably benign	Het
Bicd2	A	G	13: 49,379,846	H636R	probably damaging	Het
Chac2	A	G	11: 30,977,406	V171A	probably damaging	Het
Cnbd1	T	C	4: 18,860,462	D428G	probably damaging	Het
Crlf1	T	C	8: 70,493,340	S22P	probably benign	Het
Crybg1	A	G	10: 44,003,951	F414L	probably damaging	Het
Dnah14	A	T	1: 181,626,720	D765V	possibly damaging	Het
Fat3	A	G	9: 15,937,991		probably null	Het
Gabbr1	A	T	17: 37,056,899	M414L	possibly damaging	Het
Gm960	G	C	19: 4,672,078	P105A	probably damaging	Het
Grip2	A	T	6: 91,780,438	D412E	probably damaging	Het
Herc1	G	A	9: 66,487,976	A4198T	possibly damaging	Het
Hsd3b3	C	T	3: 98,755,949		probably null	Het
Ifi213	G	A	1: 173,590,282	T188I	possibly damaging	Het
Il1f5	G	A	2: 24,279,714	A29T	probably damaging	Het
Kdelc2	G	A	9: 53,390,440	V131M	probably damaging	Het
Klk1b11	T	C	7: 43,997,851		probably null	Het
Mepce	A	T	5: 137,785,436	D209E	possibly damaging	Het
Mtr	A	C	13: 12,247,954	V111G	possibly damaging	Het
Olfr1058	T	A	2: 86,386,169	Q83L	probably benign	Het
Olfr826	A	T	10: 130,180,297	N194K	probably benign	Het
Olfr93	A	G	17: 37,151,606	V122A	probably damaging	Het
P2rx1	G	A	11: 72,999,322	R3Q	probably benign	Het
Phc2	G	A	4: 128,705,151	G34S	probably benign	Het
Ppm1a	A	G	12: 72,790,675	H332R	probably benign	Het
Sdk2	A	G	11: 113,893,508	V135A	probably benign	Het
Skiv2l2	T	A	13: 112,910,917	H298L	possibly damaging	Het
Slc2a4	T	C	11: 69,945,022	T334A	probably benign	Het
Slc6a15	T	G	10: 103,404,367	V317G	probably damaging	Het
Speer2	T	C	16: 69,858,007	D190G	possibly damaging	Het
Tbc1d21	G	A	9: 58,361,218	A286V	probably benign	Het
Tmem210	T	C	2: 25,288,784	S82P	probably benign	Het
Zbtb26	C	T	2: 37,435,675	V450M	probably benign	Het

Other mutations in Chd9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Chd9	APN	8	91025392	missense	possibly damaging	0.79
IGL00547:Chd9	APN	8	91005798	missense	probably damaging	1.00
IGL00589:Chd9	APN	8	91015846	missense	probably damaging	1.00
IGL00640:Chd9	APN	8	90986132	missense	probably damaging	0.99
IGL00663:Chd9	APN	8	90983490	missense	probably damaging	1.00
IGL00852:Chd9	APN	8	90973207	missense	probably benign	0.29
IGL00908:Chd9	APN	8	90996880	missense	probably damaging	1.00
IGL00911:Chd9	APN	8	91051692	missense	probably damaging	1.00
IGL01068:Chd9	APN	8	91042116	missense	probably benign	0.13
IGL01668:Chd9	APN	8	91026776	missense	possibly damaging	0.53
IGL01873:Chd9	APN	8	90933767	missense	probably benign	0.00
IGL01969:Chd9	APN	8	91033510	missense	possibly damaging	0.72
IGL02105:Chd9	APN	8	90932488	missense	probably damaging	1.00
IGL02153:Chd9	APN	8	90956494	nonsense	probably null
IGL02164:Chd9	APN	8	90933221	missense	possibly damaging	0.94
IGL02725:Chd9	APN	8	91051684	missense	possibly damaging	0.78
IGL02755:Chd9	APN	8	91033582	missense	probably benign	0.33
IGL02892:Chd9	APN	8	90976915	splice site	probably benign
IGL02897:Chd9	APN	8	90933868	splice site	probably benign
IGL03005:Chd9	APN	8	91011447	missense	probably damaging	0.98
IGL03062:Chd9	APN	8	91015267	splice site	probably benign
IGL03140:Chd9	APN	8	91042228	missense	possibly damaging	0.91
hovel	UTSW	8	91015204	missense	probably benign	0.19
shack	UTSW	8	90932798	missense	probably damaging	1.00
R0056:Chd9	UTSW	8	90933537	missense	possibly damaging	0.62
R0157:Chd9	UTSW	8	91008836	splice site	probably null
R0238:Chd9	UTSW	8	90932828	missense	probably damaging	1.00
R0238:Chd9	UTSW	8	90932828	missense	probably damaging	1.00
R0432:Chd9	UTSW	8	90994450	splice site	probably benign
R0454:Chd9	UTSW	8	90973231	missense	possibly damaging	0.83
R0573:Chd9	UTSW	8	90998595	missense	probably damaging	1.00
R0580:Chd9	UTSW	8	90994563	missense	possibly damaging	0.91
R0604:Chd9	UTSW	8	91036542	missense	possibly damaging	0.82
R0662:Chd9	UTSW	8	90977676	missense	probably damaging	0.99
R0825:Chd9	UTSW	8	91051197	missense	probably benign	0.06
R0945:Chd9	UTSW	8	90933002	missense	possibly damaging	0.60
R0964:Chd9	UTSW	8	91015204	missense	probably benign	0.19
R0967:Chd9	UTSW	8	90989479	missense	probably damaging	1.00
R1015:Chd9	UTSW	8	90932578	missense	probably damaging	0.99
R1066:Chd9	UTSW	8	90986136	nonsense	probably null
R1244:Chd9	UTSW	8	91022929	missense	probably damaging	0.99
R1505:Chd9	UTSW	8	91006495	splice site	probably null
R1570:Chd9	UTSW	8	91036542	missense	probably benign	0.03
R1591:Chd9	UTSW	8	90983538	missense	probably damaging	0.97
R1624:Chd9	UTSW	8	90998535	missense	probably benign	0.17
R1626:Chd9	UTSW	8	90994596	missense	probably benign	0.00
R1632:Chd9	UTSW	8	90956707	nonsense	probably null
R1649:Chd9	UTSW	8	90932601	missense	possibly damaging	0.88
R1664:Chd9	UTSW	8	91022790	splice site	probably null
R1668:Chd9	UTSW	8	91041186	missense	probably damaging	0.99
R1681:Chd9	UTSW	8	90973135	missense	probably damaging	0.98
R1695:Chd9	UTSW	8	91001782	missense	probably damaging	1.00
R1714:Chd9	UTSW	8	91034225	utr 3 prime	probably benign
R1746:Chd9	UTSW	8	91010698	missense	probably benign	0.01
R1843:Chd9	UTSW	8	91010794	missense	probably benign	0.19
R1844:Chd9	UTSW	8	90956695	nonsense	probably null
R1941:Chd9	UTSW	8	90977069	critical splice donor site	probably null
R2022:Chd9	UTSW	8	91035054	missense	probably benign	0.17
R2027:Chd9	UTSW	8	90907991	unclassified	probably benign
R2098:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2099:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2100:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2101:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2224:Chd9	UTSW	8	91011285	missense	probably benign	0.04
R2276:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2278:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2316:Chd9	UTSW	8	91051128	missense	probably damaging	0.99
R2507:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2508:Chd9	UTSW	8	91033987	missense	probably benign	0.01
R2988:Chd9	UTSW	8	91030460	splice site	probably null
R3418:Chd9	UTSW	8	91036591	missense	probably damaging	1.00
R3817:Chd9	UTSW	8	90984265	splice site	probably benign
R3923:Chd9	UTSW	8	90933519	missense	probably benign	0.16
R4001:Chd9	UTSW	8	90956557	missense	probably damaging	1.00
R4003:Chd9	UTSW	8	90956557	missense	probably damaging	1.00
R4006:Chd9	UTSW	8	90933560	missense	probably benign	0.12
R4013:Chd9	UTSW	8	90973169	missense	possibly damaging	0.82
R4067:Chd9	UTSW	8	91023574	missense	possibly damaging	0.53
R4108:Chd9	UTSW	8	91010676	missense	probably benign	0.04
R4125:Chd9	UTSW	8	91051284	missense	probably damaging	0.99
R4126:Chd9	UTSW	8	91051284	missense	probably damaging	0.99
R4452:Chd9	UTSW	8	90977680	missense	probably damaging	0.99
R4463:Chd9	UTSW	8	90978999	missense	probably benign	0.01
R4478:Chd9	UTSW	8	91034031	utr 3 prime	probably benign
R4587:Chd9	UTSW	8	91036506	missense	possibly damaging	0.95
R4628:Chd9	UTSW	8	90983463	missense	probably benign	0.05
R4667:Chd9	UTSW	8	91033800	missense	possibly damaging	0.73
R4908:Chd9	UTSW	8	91015249	missense	possibly damaging	0.50
R4912:Chd9	UTSW	8	91034230	missense	possibly damaging	0.84
R4977:Chd9	UTSW	8	91033708	missense	possibly damaging	0.96
R5016:Chd9	UTSW	8	91006626	nonsense	probably null
R5083:Chd9	UTSW	8	90984374	missense	probably damaging	1.00
R5088:Chd9	UTSW	8	90977519	missense	possibly damaging	0.94
R5090:Chd9	UTSW	8	91026834	nonsense	probably null
R5307:Chd9	UTSW	8	90997149	missense	probably damaging	1.00
R5541:Chd9	UTSW	8	91051504	missense	probably benign	0.09
R5559:Chd9	UTSW	8	91015925	critical splice donor site	probably null
R5638:Chd9	UTSW	8	91011450	missense	possibly damaging	0.67
R5640:Chd9	UTSW	8	91036562	missense	probably damaging	1.00
R5793:Chd9	UTSW	8	91001756	missense	probably damaging	1.00
R5827:Chd9	UTSW	8	90989450	missense	probably damaging	1.00
R5834:Chd9	UTSW	8	90997164	missense	probably damaging	1.00
R5875:Chd9	UTSW	8	91051836	missense	probably damaging	0.99
R6002:Chd9	UTSW	8	90978887	missense	probably damaging	1.00
R6091:Chd9	UTSW	8	91035063	missense	probably damaging	1.00
R6185:Chd9	UTSW	8	91049137	missense	probably damaging	1.00
R6246:Chd9	UTSW	8	90932417	missense	probably damaging	1.00
R6292:Chd9	UTSW	8	90932922	missense	probably benign	0.05
R6305:Chd9	UTSW	8	91030546	missense	possibly damaging	0.93
R6438:Chd9	UTSW	8	90998521	missense	probably benign	0.02
R6470:Chd9	UTSW	8	90932798	missense	probably damaging	1.00
R6798:Chd9	UTSW	8	91051554	missense	possibly damaging	0.56
R6902:Chd9	UTSW	8	91042951	missense	probably damaging	1.00
R6908:Chd9	UTSW	8	90956416	missense	probably benign	0.02
R6929:Chd9	UTSW	8	91042945	missense	probably damaging	1.00
R6969:Chd9	UTSW	8	90978914	missense	probably benign	0.34
R7043:Chd9	UTSW	8	91034215	utr 3 prime	probably benign
R7094:Chd9	UTSW	8	90989561	missense	unknown
R7126:Chd9	UTSW	8	91015225	missense	unknown
R7182:Chd9	UTSW	8	91006622	missense	unknown
R7219:Chd9	UTSW	8	91001766	missense	unknown
R7260:Chd9	UTSW	8	90994543	missense	unknown
R7293:Chd9	UTSW	8	91034079	missense	unknown
R7303:Chd9	UTSW	8	91051904	missense	unknown
R7358:Chd9	UTSW	8	90983487	missense	unknown
R7358:Chd9	UTSW	8	91034218	missense	unknown
R7451:Chd9	UTSW	8	91033790	frame shift	probably null
R7451:Chd9	UTSW	8	91033818	missense	probably benign	0.27
R7456:Chd9	UTSW	8	90932525	nonsense	probably null
R7481:Chd9	UTSW	8	90956438	missense	unknown
R7532:Chd9	UTSW	8	90994565	missense	unknown
R7570:Chd9	UTSW	8	90994580	missense	unknown
R7611:Chd9	UTSW	8	91036389	missense	probably damaging	1.00
R7673:Chd9	UTSW	8	91051697	missense	probably damaging	0.96
R7723:Chd9	UTSW	8	91015209	missense	unknown
R7739:Chd9	UTSW	8	91035025	missense	probably damaging	1.00
R7759:Chd9	UTSW	8	90977550	critical splice donor site	probably null
R7916:Chd9	UTSW	8	91035056	nonsense	probably null
R7921:Chd9	UTSW	8	91042281	critical splice donor site	probably null
R7957:Chd9	UTSW	8	91051698	missense	probably damaging	0.99
R7972:Chd9	UTSW	8	91005767	missense	unknown
R8108:Chd9	UTSW	8	90933224	missense	unknown
R8115:Chd9	UTSW	8	91036332	missense	probably damaging	0.99
R8165:Chd9	UTSW	8	91041141	missense	probably damaging	1.00
R8171:Chd9	UTSW	8	91025387	missense	possibly damaging	0.92
R8186:Chd9	UTSW	8	90998605	missense	unknown
R8208:Chd9	UTSW	8	91037263	splice site	probably null
R8256:Chd9	UTSW	8	90933501	missense	unknown
R8281:Chd9	UTSW	8	91036597	missense	probably damaging	1.00
R8504:Chd9	UTSW	8	90996844	missense	unknown
R8836:Chd9	UTSW	8	91041184	missense	probably damaging	0.99
R8892:Chd9	UTSW	8	90933840	missense	unknown
R8985:Chd9	UTSW	8	90994473	missense	unknown
R9029:Chd9	UTSW	8	90956570	missense	unknown
R9030:Chd9	UTSW	8	90956570	missense	unknown
R9038:Chd9	UTSW	8	90989605	missense	unknown
R9081:Chd9	UTSW	8	90977516	nonsense	probably null
R9134:Chd9	UTSW	8	90933126	missense	unknown
R9205:Chd9	UTSW	8	91030642	missense	probably benign	0.01
R9309:Chd9	UTSW	8	91006691	missense	unknown
R9375:Chd9	UTSW	8	90998707	critical splice donor site	probably null
R9449:Chd9	UTSW	8	90932546	missense	unknown
R9547:Chd9	UTSW	8	90956558	missense	unknown
R9573:Chd9	UTSW	8	90977674	missense	unknown
R9576:Chd9	UTSW	8	90932666	missense	unknown
R9601:Chd9	UTSW	8	91005732	nonsense	probably null
R9613:Chd9	UTSW	8	90956522	nonsense	probably null
R9639:Chd9	UTSW	8	91034212	missense	probably null
R9718:Chd9	UTSW	8	90986173	missense	unknown
R9746:Chd9	UTSW	8	91011435	missense	unknown
R9762:Chd9	UTSW	8	90986113	missense	unknown
R9764:Chd9	UTSW	8	90994592	missense	unknown
R9790:Chd9	UTSW	8	91033789	missense	possibly damaging	0.82
R9791:Chd9	UTSW	8	91033789	missense	possibly damaging	0.82
RF007:Chd9	UTSW	8	91033950	missense	possibly damaging	0.66
X0065:Chd9	UTSW	8	91036572	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGTAATACAAAGCAGACAGTGTC -3'
(R):5'- TAAGTGATTCTGCAGCTCTCG -3'

Sequencing Primer
(F):5'- TGTCCCTGAGTCAGACATACTCTAAG -3'
(R):5'- GATTCTGCAGCTCTCGAGTCTG -3'

Posted On

2018-04-27