Incidental Mutation 'R6348:Tbc1d21'
ID514446
Institutional Source Beutler Lab
Gene Symbol Tbc1d21
Ensembl Gene ENSMUSG00000036244
Gene NameTBC1 domain family, member 21
Synonyms1700095K08Rik, MgcRabGAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R6348 (G1)
Quality Score185.009
Status Validated
Chromosome9
Chromosomal Location58359704-58370455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58361218 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 286 (A286V)
Ref Sequence ENSEMBL: ENSMUSP00000037525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040217] [ENSMUST00000213847]
Predicted Effect probably benign
Transcript: ENSMUST00000040217
AA Change: A286V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037525
Gene: ENSMUSG00000036244
AA Change: A286V

DomainStartEndE-ValueType
TBC 54 291 1.76e-4 SMART
Predicted Effect silent
Transcript: ENSMUST00000213847
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,414,595 H400Q probably damaging Het
Arhgef16 G T 4: 154,287,083 Q218K probably benign Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atic C T 1: 71,576,698 R468W probably damaging Het
Bfsp2 A T 9: 103,480,072 V52D probably benign Het
Bicd2 A G 13: 49,379,846 H636R probably damaging Het
Chac2 A G 11: 30,977,406 V171A probably damaging Het
Chd9 A G 8: 91,011,275 I1512V possibly damaging Het
Cnbd1 T C 4: 18,860,462 D428G probably damaging Het
Crlf1 T C 8: 70,493,340 S22P probably benign Het
Crybg1 A G 10: 44,003,951 F414L probably damaging Het
Dnah14 A T 1: 181,626,720 D765V possibly damaging Het
Fat3 A G 9: 15,937,991 probably null Het
Gabbr1 A T 17: 37,056,899 M414L possibly damaging Het
Gm960 G C 19: 4,672,078 P105A probably damaging Het
Grip2 A T 6: 91,780,438 D412E probably damaging Het
Herc1 G A 9: 66,487,976 A4198T possibly damaging Het
Hsd3b3 C T 3: 98,755,949 probably null Het
Ifi213 G A 1: 173,590,282 T188I possibly damaging Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kdelc2 G A 9: 53,390,440 V131M probably damaging Het
Klk1b11 T C 7: 43,997,851 probably null Het
Mepce A T 5: 137,785,436 D209E possibly damaging Het
Mtr A C 13: 12,247,954 V111G possibly damaging Het
Olfr1058 T A 2: 86,386,169 Q83L probably benign Het
Olfr826 A T 10: 130,180,297 N194K probably benign Het
Olfr93 A G 17: 37,151,606 V122A probably damaging Het
P2rx1 G A 11: 72,999,322 R3Q probably benign Het
Phc2 G A 4: 128,705,151 G34S probably benign Het
Ppm1a A G 12: 72,790,675 H332R probably benign Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Skiv2l2 T A 13: 112,910,917 H298L possibly damaging Het
Slc2a4 T C 11: 69,945,022 T334A probably benign Het
Slc6a15 T G 10: 103,404,367 V317G probably damaging Het
Speer2 T C 16: 69,858,007 D190G possibly damaging Het
Tmem210 T C 2: 25,288,784 S82P probably benign Het
Zbtb26 C T 2: 37,435,675 V450M probably benign Het
Other mutations in Tbc1d21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Tbc1d21 APN 9 58362462 missense possibly damaging 0.78
IGL02118:Tbc1d21 APN 9 58360463 missense probably benign 0.00
IGL02651:Tbc1d21 APN 9 58363101 nonsense probably null
R0693:Tbc1d21 UTSW 9 58361287 missense probably damaging 1.00
R0730:Tbc1d21 UTSW 9 58359877 missense probably benign 0.00
R1454:Tbc1d21 UTSW 9 58362813 critical splice donor site probably null
R1776:Tbc1d21 UTSW 9 58366728 splice site probably benign
R2230:Tbc1d21 UTSW 9 58363080 missense probably damaging 1.00
R2512:Tbc1d21 UTSW 9 58362912 missense probably damaging 1.00
R3052:Tbc1d21 UTSW 9 58363069 missense probably damaging 1.00
R3053:Tbc1d21 UTSW 9 58363069 missense probably damaging 1.00
R6805:Tbc1d21 UTSW 9 58361288 missense possibly damaging 0.91
R7032:Tbc1d21 UTSW 9 58366851 critical splice donor site probably null
R7153:Tbc1d21 UTSW 9 58363093 missense probably damaging 1.00
R7640:Tbc1d21 UTSW 9 58361261 missense probably damaging 1.00
R7753:Tbc1d21 UTSW 9 58362023 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGGGCCTTTGAGGATTCTAC -3'
(R):5'- CCCTGGATTGCTAAGCTCTG -3'

Sequencing Primer
(F):5'- ATCATCATGGAACTGCATCCTG -3'
(R):5'- ACAGAGTTGAAGCCTGCT -3'
Posted On2018-04-27