Incidental Mutation 'R6348:Bfsp2'
ID514448
Institutional Source Beutler Lab
Gene Symbol Bfsp2
Ensembl Gene ENSMUSG00000032556
Gene Namebeaded filament structural protein 2, phakinin
SynonymsCP49
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6348 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location103424924-103480420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103480072 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 52 (V52D)
Ref Sequence ENSEMBL: ENSMUSP00000116249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049452] [ENSMUST00000124310] [ENSMUST00000189066] [ENSMUST00000189588]
Predicted Effect probably benign
Transcript: ENSMUST00000049452
SMART Domains Protein: ENSMUSP00000046021
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TMEM108 61 574 1.6e-275 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124310
AA Change: V52D

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116249
Gene: ENSMUSG00000032556
AA Change: V52D

DomainStartEndE-ValueType
Filament 102 416 6.85e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144420
Predicted Effect probably benign
Transcript: ENSMUST00000189066
SMART Domains Protein: ENSMUSP00000141160
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189588
SMART Domains Protein: ENSMUSP00000140027
Gene: ENSMUSG00000042757

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191069
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] More than 99% of the vertebrate ocular lens is comprised of terminally differentiated lens fiber cells. Two lens-specific intermediate filament-like proteins, the protein product of this gene (phakinin), and filensin, are expressed only after fiber cell differentiation has begun. Both proteins are found in a structurally unique cytoskeletal element that is referred to as the beaded filament (BF). Mutations in this gene have been associated with juvenile-onset, progressive cataracts and Dowling-Meara epidermolysis bullosa simplex. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mutations at this locus result in eye abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,414,595 H400Q probably damaging Het
Arhgef16 G T 4: 154,287,083 Q218K probably benign Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atic C T 1: 71,576,698 R468W probably damaging Het
Bicd2 A G 13: 49,379,846 H636R probably damaging Het
Chac2 A G 11: 30,977,406 V171A probably damaging Het
Chd9 A G 8: 91,011,275 I1512V possibly damaging Het
Cnbd1 T C 4: 18,860,462 D428G probably damaging Het
Crlf1 T C 8: 70,493,340 S22P probably benign Het
Crybg1 A G 10: 44,003,951 F414L probably damaging Het
Dnah14 A T 1: 181,626,720 D765V possibly damaging Het
Fat3 A G 9: 15,937,991 probably null Het
Gabbr1 A T 17: 37,056,899 M414L possibly damaging Het
Gm960 G C 19: 4,672,078 P105A probably damaging Het
Grip2 A T 6: 91,780,438 D412E probably damaging Het
Herc1 G A 9: 66,487,976 A4198T possibly damaging Het
Hsd3b3 C T 3: 98,755,949 probably null Het
Ifi213 G A 1: 173,590,282 T188I possibly damaging Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kdelc2 G A 9: 53,390,440 V131M probably damaging Het
Klk1b11 T C 7: 43,997,851 probably null Het
Mepce A T 5: 137,785,436 D209E possibly damaging Het
Mtr A C 13: 12,247,954 V111G possibly damaging Het
Olfr1058 T A 2: 86,386,169 Q83L probably benign Het
Olfr826 A T 10: 130,180,297 N194K probably benign Het
Olfr93 A G 17: 37,151,606 V122A probably damaging Het
P2rx1 G A 11: 72,999,322 R3Q probably benign Het
Phc2 G A 4: 128,705,151 G34S probably benign Het
Ppm1a A G 12: 72,790,675 H332R probably benign Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Skiv2l2 T A 13: 112,910,917 H298L possibly damaging Het
Slc2a4 T C 11: 69,945,022 T334A probably benign Het
Slc6a15 T G 10: 103,404,367 V317G probably damaging Het
Speer2 T C 16: 69,858,007 D190G possibly damaging Het
Tbc1d21 G A 9: 58,361,218 A286V probably benign Het
Tmem210 T C 2: 25,288,784 S82P probably benign Het
Zbtb26 C T 2: 37,435,675 V450M probably benign Het
Other mutations in Bfsp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Bfsp2 APN 9 103453098 missense possibly damaging 0.90
IGL01160:Bfsp2 APN 9 103480168 missense probably benign 0.02
R0408:Bfsp2 UTSW 9 103480100 missense probably benign 0.06
R0463:Bfsp2 UTSW 9 103426655 missense possibly damaging 0.94
R1454:Bfsp2 UTSW 9 103480225 start codon destroyed probably null 0.59
R1854:Bfsp2 UTSW 9 103449831 missense probably benign 0.01
R2139:Bfsp2 UTSW 9 103449875 missense probably benign 0.19
R2187:Bfsp2 UTSW 9 103426777 nonsense probably null
R3975:Bfsp2 UTSW 9 103480072 missense probably benign 0.00
R4823:Bfsp2 UTSW 9 103479883 missense probably damaging 1.00
R5035:Bfsp2 UTSW 9 103479866 missense probably benign 0.35
R5973:Bfsp2 UTSW 9 103432657 critical splice donor site probably null
R6005:Bfsp2 UTSW 9 103448550 missense probably damaging 0.99
R6106:Bfsp2 UTSW 9 103479824 missense probably benign 0.09
R6364:Bfsp2 UTSW 9 103448628 missense probably damaging 0.98
R6701:Bfsp2 UTSW 9 103479878 missense possibly damaging 0.68
R6736:Bfsp2 UTSW 9 103480204 missense possibly damaging 0.60
R7129:Bfsp2 UTSW 9 103479919 missense probably damaging 0.99
R7204:Bfsp2 UTSW 9 103432666 missense probably damaging 0.99
R7329:Bfsp2 UTSW 9 103449922 missense probably benign 0.01
R7453:Bfsp2 UTSW 9 103453107 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTAGTGTGATCCCTTTCTG -3'
(R):5'- TGAATGCCCGAAGCTCATGG -3'

Sequencing Primer
(F):5'- TTTCTGGGCCCGGAGCAG -3'
(R):5'- TGGACCCTGTAAACCTGCCAG -3'
Posted On2018-04-27