Mutagenetix > Incidental Mutations

Incidental Mutation 'R6348:Slc6a15'

514450

Institutional Source

Beutler Lab

Gene Symbol

Slc6a15

Ensembl Gene

ENSMUSG00000019894

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 15

Synonyms

v7-3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6348 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103367783-103419377 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 103404367 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 317 (V317G)

Ref Sequence

ENSEMBL: ENSMUSP00000136676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]

Predicted Effect

probably damaging
Transcript: ENSMUST00000074204
AA Change: V317G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: V317G

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000179636
AA Change: V317G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: V317G

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Meta Mutation Damage Score

0.9239

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox5	A	T	6: 116,414,595	H400Q	probably damaging	Het
Arhgef16	G	T	4: 154,287,083	Q218K	probably benign	Het
Asxl3	A	T	18: 22,517,273	H773L	possibly damaging	Het
Atic	C	T	1: 71,576,698	R468W	probably damaging	Het
Bfsp2	A	T	9: 103,480,072	V52D	probably benign	Het
Bicd2	A	G	13: 49,379,846	H636R	probably damaging	Het
Chac2	A	G	11: 30,977,406	V171A	probably damaging	Het
Chd9	A	G	8: 91,011,275	I1512V	possibly damaging	Het
Cnbd1	T	C	4: 18,860,462	D428G	probably damaging	Het
Crlf1	T	C	8: 70,493,340	S22P	probably benign	Het
Crybg1	A	G	10: 44,003,951	F414L	probably damaging	Het
Dnah14	A	T	1: 181,626,720	D765V	possibly damaging	Het
Fat3	A	G	9: 15,937,991		probably null	Het
Gabbr1	A	T	17: 37,056,899	M414L	possibly damaging	Het
Gm960	G	C	19: 4,672,078	P105A	probably damaging	Het
Grip2	A	T	6: 91,780,438	D412E	probably damaging	Het
Herc1	G	A	9: 66,487,976	A4198T	possibly damaging	Het
Hsd3b3	C	T	3: 98,755,949		probably null	Het
Ifi213	G	A	1: 173,590,282	T188I	possibly damaging	Het
Il1f5	G	A	2: 24,279,714	A29T	probably damaging	Het
Kdelc2	G	A	9: 53,390,440	V131M	probably damaging	Het
Klk1b11	T	C	7: 43,997,851		probably null	Het
Mepce	A	T	5: 137,785,436	D209E	possibly damaging	Het
Mtr	A	C	13: 12,247,954	V111G	possibly damaging	Het
Olfr1058	T	A	2: 86,386,169	Q83L	probably benign	Het
Olfr826	A	T	10: 130,180,297	N194K	probably benign	Het
Olfr93	A	G	17: 37,151,606	V122A	probably damaging	Het
P2rx1	G	A	11: 72,999,322	R3Q	probably benign	Het
Phc2	G	A	4: 128,705,151	G34S	probably benign	Het
Ppm1a	A	G	12: 72,790,675	H332R	probably benign	Het
Sdk2	A	G	11: 113,893,508	V135A	probably benign	Het
Skiv2l2	T	A	13: 112,910,917	H298L	possibly damaging	Het
Slc2a4	T	C	11: 69,945,022	T334A	probably benign	Het
Speer2	T	C	16: 69,858,007	D190G	possibly damaging	Het
Tbc1d21	G	A	9: 58,361,218	A286V	probably benign	Het
Tmem210	T	C	2: 25,288,784	S82P	probably benign	Het
Zbtb26	C	T	2: 37,435,675	V450M	probably benign	Het

Other mutations in Slc6a15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Slc6a15	APN	10	103389141	missense	probably benign
IGL01320:Slc6a15	APN	10	103404745	missense	probably benign	0.00
IGL01924:Slc6a15	APN	10	103404825	splice site	probably null
IGL02066:Slc6a15	APN	10	103416658	missense	probably damaging	0.98
IGL02164:Slc6a15	APN	10	103418222	missense	probably benign	0.01
IGL02551:Slc6a15	APN	10	103404275	splice site	probably benign
IGL02744:Slc6a15	APN	10	103418033	missense	probably benign	0.03
R0028:Slc6a15	UTSW	10	103416680	missense	probably benign	0.00
R0143:Slc6a15	UTSW	10	103418068	missense	probably benign	0.02
R0158:Slc6a15	UTSW	10	103389347	splice site	probably benign
R0165:Slc6a15	UTSW	10	103409809	missense	probably null	0.04
R0349:Slc6a15	UTSW	10	103418225	missense	probably benign	0.06
R0383:Slc6a15	UTSW	10	103418053	missense	probably damaging	1.00
R0614:Slc6a15	UTSW	10	103404352	nonsense	probably null
R0784:Slc6a15	UTSW	10	103416800	splice site	probably benign
R0944:Slc6a15	UTSW	10	103409796	missense	probably benign	0.01
R1795:Slc6a15	UTSW	10	103400260	missense	probably benign
R1882:Slc6a15	UTSW	10	103395064	missense	probably benign	0.20
R2061:Slc6a15	UTSW	10	103409734	missense	probably benign	0.20
R2156:Slc6a15	UTSW	10	103393408	missense	probably damaging	1.00
R2358:Slc6a15	UTSW	10	103416785	missense	probably benign	0.00
R2849:Slc6a15	UTSW	10	103404691	missense	probably benign	0.01
R2921:Slc6a15	UTSW	10	103418387	missense	probably damaging	0.99
R3709:Slc6a15	UTSW	10	103393414	missense	probably benign	0.00
R4532:Slc6a15	UTSW	10	103409787	missense	possibly damaging	0.69
R4825:Slc6a15	UTSW	10	103418060	missense	probably benign	0.05
R4909:Slc6a15	UTSW	10	103404414	missense	probably damaging	1.00
R5112:Slc6a15	UTSW	10	103389226	missense	probably benign
R5320:Slc6a15	UTSW	10	103408206	missense	probably damaging	1.00
R5364:Slc6a15	UTSW	10	103393508	missense	probably damaging	0.99
R6305:Slc6a15	UTSW	10	103389170	missense	probably benign	0.31
R6729:Slc6a15	UTSW	10	103393914	missense	probably damaging	0.99
R6781:Slc6a15	UTSW	10	103395067	missense	probably damaging	0.99
R7409:Slc6a15	UTSW	10	103408302	missense	probably benign
R7549:Slc6a15	UTSW	10	103389137	missense	probably benign
R7660:Slc6a15	UTSW	10	103393380	splice site	probably null
R7839:Slc6a15	UTSW	10	103404799	missense	probably benign
R7948:Slc6a15	UTSW	10	103404295	missense	possibly damaging	0.95
R8278:Slc6a15	UTSW	10	103394029	critical splice donor site	probably null
R8379:Slc6a15	UTSW	10	103389187	missense	probably benign	0.00
R8685:Slc6a15	UTSW	10	103409695	missense	possibly damaging	0.68
R8712:Slc6a15	UTSW	10	103389251	missense	probably damaging	1.00
R8719:Slc6a15	UTSW	10	103404315	missense	probably damaging	0.99
RF013:Slc6a15	UTSW	10	103400216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGTTGCATTCTTAGGTGC -3'
(R):5'- CAGATGGAGAATGAGCACCC -3'

Sequencing Primer
(F):5'- TGCATTCTTAGGTGCTTTCCTAG -3'
(R):5'- GAATTATGCCATGAAATGCTAGTGG -3'

Posted On

2018-04-27