Incidental Mutation 'R6348:Slc6a15'
ID 514450
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6348 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 103367783-103419377 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 103404367 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 317 (V317G)
Ref Sequence ENSEMBL: ENSMUSP00000136676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
AlphaFold Q8BG16
Predicted Effect probably damaging
Transcript: ENSMUST00000074204
AA Change: V317G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: V317G

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179636
AA Change: V317G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: V317G

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Meta Mutation Damage Score 0.9239 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,414,595 H400Q probably damaging Het
Arhgef16 G T 4: 154,287,083 Q218K probably benign Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atic C T 1: 71,576,698 R468W probably damaging Het
Bfsp2 A T 9: 103,480,072 V52D probably benign Het
Bicd2 A G 13: 49,379,846 H636R probably damaging Het
Chac2 A G 11: 30,977,406 V171A probably damaging Het
Chd9 A G 8: 91,011,275 I1512V possibly damaging Het
Cnbd1 T C 4: 18,860,462 D428G probably damaging Het
Crlf1 T C 8: 70,493,340 S22P probably benign Het
Crybg1 A G 10: 44,003,951 F414L probably damaging Het
Dnah14 A T 1: 181,626,720 D765V possibly damaging Het
Fat3 A G 9: 15,937,991 probably null Het
Gabbr1 A T 17: 37,056,899 M414L possibly damaging Het
Gm960 G C 19: 4,672,078 P105A probably damaging Het
Grip2 A T 6: 91,780,438 D412E probably damaging Het
Herc1 G A 9: 66,487,976 A4198T possibly damaging Het
Hsd3b3 C T 3: 98,755,949 probably null Het
Ifi213 G A 1: 173,590,282 T188I possibly damaging Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kdelc2 G A 9: 53,390,440 V131M probably damaging Het
Klk1b11 T C 7: 43,997,851 probably null Het
Mepce A T 5: 137,785,436 D209E possibly damaging Het
Mtr A C 13: 12,247,954 V111G possibly damaging Het
Olfr1058 T A 2: 86,386,169 Q83L probably benign Het
Olfr826 A T 10: 130,180,297 N194K probably benign Het
Olfr93 A G 17: 37,151,606 V122A probably damaging Het
P2rx1 G A 11: 72,999,322 R3Q probably benign Het
Phc2 G A 4: 128,705,151 G34S probably benign Het
Ppm1a A G 12: 72,790,675 H332R probably benign Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Skiv2l2 T A 13: 112,910,917 H298L possibly damaging Het
Slc2a4 T C 11: 69,945,022 T334A probably benign Het
Speer2 T C 16: 69,858,007 D190G possibly damaging Het
Tbc1d21 G A 9: 58,361,218 A286V probably benign Het
Tmem210 T C 2: 25,288,784 S82P probably benign Het
Zbtb26 C T 2: 37,435,675 V450M probably benign Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103389141 missense probably benign
IGL01320:Slc6a15 APN 10 103404745 missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103404825 splice site probably null
IGL02066:Slc6a15 APN 10 103416658 missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103418222 missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103404275 splice site probably benign
IGL02744:Slc6a15 APN 10 103418033 missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103416680 missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103418068 missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103389347 splice site probably benign
R0165:Slc6a15 UTSW 10 103409809 missense probably null 0.04
R0349:Slc6a15 UTSW 10 103418225 missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103418053 missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103404352 nonsense probably null
R0784:Slc6a15 UTSW 10 103416800 splice site probably benign
R0944:Slc6a15 UTSW 10 103409796 missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103400260 missense probably benign
R1882:Slc6a15 UTSW 10 103395064 missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103409734 missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103393408 missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103416785 missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103404691 missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103418387 missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103393414 missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103409787 missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103418060 missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103404414 missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103389226 missense probably benign
R5320:Slc6a15 UTSW 10 103408206 missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103393508 missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103389170 missense probably benign 0.31
R6729:Slc6a15 UTSW 10 103393914 missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103395067 missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103408302 missense probably benign
R7549:Slc6a15 UTSW 10 103389137 missense probably benign
R7660:Slc6a15 UTSW 10 103393380 splice site probably null
R7839:Slc6a15 UTSW 10 103404799 missense probably benign
R7948:Slc6a15 UTSW 10 103404295 missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103394029 critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103389187 missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103409695 missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103389251 missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103404315 missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103389318 missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103393496 missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103395092 nonsense probably null
R9050:Slc6a15 UTSW 10 103416655 missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103400279 missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103393545 nonsense probably null
R9493:Slc6a15 UTSW 10 103393416 missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103404722 missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103404472 missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103400216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTTGCATTCTTAGGTGC -3'
(R):5'- CAGATGGAGAATGAGCACCC -3'

Sequencing Primer
(F):5'- TGCATTCTTAGGTGCTTTCCTAG -3'
(R):5'- GAATTATGCCATGAAATGCTAGTGG -3'
Posted On 2018-04-27