Incidental Mutation 'R6348:Ppm1a'
ID514456
Institutional Source Beutler Lab
Gene Symbol Ppm1a
Ensembl Gene ENSMUSG00000021096
Gene Nameprotein phosphatase 1A, magnesium dependent, alpha isoform
Synonyms2900017D14Rik, MMPa-2, MPPa-1, 2310003C21Rik, Mpp alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6348 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location72757455-72799819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72790675 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 332 (H332R)
Ref Sequence ENSEMBL: ENSMUSP00000021514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021514] [ENSMUST00000221628] [ENSMUST00000222896]
Predicted Effect probably benign
Transcript: ENSMUST00000021514
AA Change: H332R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021514
Gene: ENSMUSG00000021096
AA Change: H332R

DomainStartEndE-ValueType
PP2Cc 13 289 5.08e-106 SMART
PP2C_SIG 38 291 1.26e-1 SMART
Blast:PP2Cc 295 335 6e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000221628
Predicted Effect probably benign
Transcript: ENSMUST00000222896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223410
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase dephosphorylates, and negatively regulates the activities of, MAP kinases and MAP kinase kinases. It has been shown to inhibit the activation of p38 and JNK kinase cascades induced by environmental stresses. This phosphatase can also dephosphorylate cyclin-dependent kinases, and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to activate the expression of the tumor suppressor gene TP53/p53, which leads to G2/M cell cycle arrest and apoptosis. Three alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit delayed wound healing, delayed re-epithelialization, and decreased keratinocyte migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,414,595 H400Q probably damaging Het
Arhgef16 G T 4: 154,287,083 Q218K probably benign Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atic C T 1: 71,576,698 R468W probably damaging Het
Bfsp2 A T 9: 103,480,072 V52D probably benign Het
Bicd2 A G 13: 49,379,846 H636R probably damaging Het
Chac2 A G 11: 30,977,406 V171A probably damaging Het
Chd9 A G 8: 91,011,275 I1512V possibly damaging Het
Cnbd1 T C 4: 18,860,462 D428G probably damaging Het
Crlf1 T C 8: 70,493,340 S22P probably benign Het
Crybg1 A G 10: 44,003,951 F414L probably damaging Het
Dnah14 A T 1: 181,626,720 D765V possibly damaging Het
Fat3 A G 9: 15,937,991 probably null Het
Gabbr1 A T 17: 37,056,899 M414L possibly damaging Het
Gm960 G C 19: 4,672,078 P105A probably damaging Het
Grip2 A T 6: 91,780,438 D412E probably damaging Het
Herc1 G A 9: 66,487,976 A4198T possibly damaging Het
Hsd3b3 C T 3: 98,755,949 probably null Het
Ifi213 G A 1: 173,590,282 T188I possibly damaging Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kdelc2 G A 9: 53,390,440 V131M probably damaging Het
Klk1b11 T C 7: 43,997,851 probably null Het
Mepce A T 5: 137,785,436 D209E possibly damaging Het
Mtr A C 13: 12,247,954 V111G possibly damaging Het
Olfr1058 T A 2: 86,386,169 Q83L probably benign Het
Olfr826 A T 10: 130,180,297 N194K probably benign Het
Olfr93 A G 17: 37,151,606 V122A probably damaging Het
P2rx1 G A 11: 72,999,322 R3Q probably benign Het
Phc2 G A 4: 128,705,151 G34S probably benign Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Skiv2l2 T A 13: 112,910,917 H298L possibly damaging Het
Slc2a4 T C 11: 69,945,022 T334A probably benign Het
Slc6a15 T G 10: 103,404,367 V317G probably damaging Het
Speer2 T C 16: 69,858,007 D190G possibly damaging Het
Tbc1d21 G A 9: 58,361,218 A286V probably benign Het
Tmem210 T C 2: 25,288,784 S82P probably benign Het
Zbtb26 C T 2: 37,435,675 V450M probably benign Het
Other mutations in Ppm1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0838:Ppm1a UTSW 12 72784320 missense probably benign 0.00
R1305:Ppm1a UTSW 12 72783720 missense probably damaging 1.00
R1802:Ppm1a UTSW 12 72793707 splice site probably null
R4864:Ppm1a UTSW 12 72783964 missense probably benign
R4895:Ppm1a UTSW 12 72784352 missense probably damaging 1.00
R5604:Ppm1a UTSW 12 72790681 missense probably benign 0.22
R7130:Ppm1a UTSW 12 72784233 missense probably benign 0.01
R7432:Ppm1a UTSW 12 72784142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCAGAAAATCTCAAGCTCGTG -3'
(R):5'- GTTCCCCAAGCTTCCACTAAGG -3'

Sequencing Primer
(F):5'- TCTCAAGCTCGTGTAGTCAAAG -3'
(R):5'- GTAACTGACATTCAAGTACTGATCCC -3'
Posted On2018-04-27