Mutagenetix > Incidental Mutation

Incidental Mutation 'R6348:Speer2'

514459

Institutional Source

Beutler Lab

Gene Symbol

Speer2

Ensembl Gene

ENSMUSG00000063163

Gene Name

spermatogenesis associated glutamate (E)-rich protein 2

Synonyms

SPEER-2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R6348 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69856874-69863744 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69858007 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 190 (D190G)

Ref Sequence

ENSEMBL: ENSMUSP00000075821 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076500] [ENSMUST00000164146] [ENSMUST00000166256]

AlphaFold

E9Q9U2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076500
AA Change: D190G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000075821
Gene: ENSMUSG00000063163
AA Change: D190G

Domain	Start	End	E-Value	Type
Pfam:Takusan	51	137	6.3e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164146

SMART Domains

Protein: ENSMUSP00000126059
Gene: ENSMUSG00000063163

Domain	Start	End	E-Value	Type
Pfam:Takusan	33	121	1.9e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166256

SMART Domains

Protein: ENSMUSP00000130270
Gene: ENSMUSG00000063163

Domain	Start	End	E-Value	Type
Pfam:Takusan	1	49	2.3e-14	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox5	A	T	6: 116,414,595	H400Q	probably damaging	Het
Arhgef16	G	T	4: 154,287,083	Q218K	probably benign	Het
Asxl3	A	T	18: 22,517,273	H773L	possibly damaging	Het
Atic	C	T	1: 71,576,698	R468W	probably damaging	Het
Bfsp2	A	T	9: 103,480,072	V52D	probably benign	Het
Bicd2	A	G	13: 49,379,846	H636R	probably damaging	Het
Chac2	A	G	11: 30,977,406	V171A	probably damaging	Het
Chd9	A	G	8: 91,011,275	I1512V	possibly damaging	Het
Cnbd1	T	C	4: 18,860,462	D428G	probably damaging	Het
Crlf1	T	C	8: 70,493,340	S22P	probably benign	Het
Crybg1	A	G	10: 44,003,951	F414L	probably damaging	Het
Dnah14	A	T	1: 181,626,720	D765V	possibly damaging	Het
Fat3	A	G	9: 15,937,991		probably null	Het
Gabbr1	A	T	17: 37,056,899	M414L	possibly damaging	Het
Gm960	G	C	19: 4,672,078	P105A	probably damaging	Het
Grip2	A	T	6: 91,780,438	D412E	probably damaging	Het
Herc1	G	A	9: 66,487,976	A4198T	possibly damaging	Het
Hsd3b3	C	T	3: 98,755,949		probably null	Het
Ifi213	G	A	1: 173,590,282	T188I	possibly damaging	Het
Il1f5	G	A	2: 24,279,714	A29T	probably damaging	Het
Kdelc2	G	A	9: 53,390,440	V131M	probably damaging	Het
Klk1b11	T	C	7: 43,997,851		probably null	Het
Mepce	A	T	5: 137,785,436	D209E	possibly damaging	Het
Mtr	A	C	13: 12,247,954	V111G	possibly damaging	Het
Olfr1058	T	A	2: 86,386,169	Q83L	probably benign	Het
Olfr826	A	T	10: 130,180,297	N194K	probably benign	Het
Olfr93	A	G	17: 37,151,606	V122A	probably damaging	Het
P2rx1	G	A	11: 72,999,322	R3Q	probably benign	Het
Phc2	G	A	4: 128,705,151	G34S	probably benign	Het
Ppm1a	A	G	12: 72,790,675	H332R	probably benign	Het
Sdk2	A	G	11: 113,893,508	V135A	probably benign	Het
Skiv2l2	T	A	13: 112,910,917	H298L	possibly damaging	Het
Slc2a4	T	C	11: 69,945,022	T334A	probably benign	Het
Slc6a15	T	G	10: 103,404,367	V317G	probably damaging	Het
Tbc1d21	G	A	9: 58,361,218	A286V	probably benign	Het
Tmem210	T	C	2: 25,288,784	S82P	probably benign	Het
Zbtb26	C	T	2: 37,435,675	V450M	probably benign	Het

Other mutations in Speer2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Speer2	APN	16	69860518	missense	probably benign	0.01
IGL01115:Speer2	APN	16	69861651	nonsense	probably null
IGL01694:Speer2	APN	16	69858112	missense	probably damaging	0.98
IGL01694:Speer2	APN	16	69858113	missense	probably damaging	1.00
IGL02738:Speer2	APN	16	69861712	missense	probably benign
IGL03024:Speer2	APN	16	69858115	missense	possibly damaging	0.95
IGL03062:Speer2	APN	16	69857977	missense	probably damaging	0.96
R0054:Speer2	UTSW	16	69858752	missense	probably damaging	0.99
R1248:Speer2	UTSW	16	69857067	splice site	probably null
R1952:Speer2	UTSW	16	69857164	missense	probably damaging	0.96
R1993:Speer2	UTSW	16	69858077	missense	probably benign	0.01
R1995:Speer2	UTSW	16	69858077	missense	probably benign	0.01
R2063:Speer2	UTSW	16	69860497	missense	probably benign	0.02
R2155:Speer2	UTSW	16	69860597	missense	possibly damaging	0.63
R2216:Speer2	UTSW	16	69858842	missense	possibly damaging	0.94
R4547:Speer2	UTSW	16	69858849	missense	probably damaging	0.98
R4548:Speer2	UTSW	16	69858849	missense	probably damaging	0.98
R4625:Speer2	UTSW	16	69858754	nonsense	probably null
R4692:Speer2	UTSW	16	69857972	missense	possibly damaging	0.91
R4841:Speer2	UTSW	16	69858100	missense	probably benign	0.26
R4842:Speer2	UTSW	16	69858100	missense	probably benign	0.26
R5035:Speer2	UTSW	16	69857941	critical splice donor site	probably null
R5133:Speer2	UTSW	16	69858820	missense	probably null	0.06
R5812:Speer2	UTSW	16	69858895	missense	possibly damaging	0.82
R6854:Speer2	UTSW	16	69858887	missense	probably damaging	0.96
R7446:Speer2	UTSW	16	69858077	missense	possibly damaging	0.82
R8068:Speer2	UTSW	16	69860524	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- TCTCACAAGAGGCTAACTTCCC -3'
(R):5'- GGGGTTAATGGGCCTATACATAC -3'

Sequencing Primer
(F):5'- CAACTGCATTCCATGAGGTG -3'
(R):5'- ATGGGCCTATACATACTAATGAGAG -3'

Posted On

2018-04-27