Incidental Mutation 'R6175:St13'
ID514474
Institutional Source Beutler Lab
Gene Symbol St13
Ensembl Gene ENSMUSG00000022403
Gene Namesuppression of tumorigenicity 13
SynonymsHsp70 interacting protein, HSPABP1, PRO0786, 1110007I03Rik, 3110002K08Rik, SNC6, p48
MMRRC Submission 044317-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R6175 (G1)
Quality Score52.0072
Status Validated
Chromosome15
Chromosomal Location81363669-81400077 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 81399305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023039] [ENSMUST00000041609] [ENSMUST00000163382] [ENSMUST00000163754] [ENSMUST00000165258] [ENSMUST00000165582] [ENSMUST00000167799] [ENSMUST00000169204] [ENSMUST00000172107]
Predicted Effect probably benign
Transcript: ENSMUST00000023039
SMART Domains Protein: ENSMUSP00000023039
Gene: ENSMUSG00000022403

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 6e-25 PDB
low complexity region 52 72 N/A INTRINSIC
TPR 104 137 1.2e1 SMART
TPR 138 171 6.95e-4 SMART
TPR 172 205 4.8e1 SMART
coiled coil region 225 264 N/A INTRINSIC
low complexity region 271 305 N/A INTRINSIC
STI1 312 351 3.37e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041609
SMART Domains Protein: ENSMUSP00000038331
Gene: ENSMUSG00000022401

DomainStartEndE-ValueType
AMP_N 67 213 6.36e-54 SMART
Pfam:Peptidase_M24 253 366 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163296
Predicted Effect probably benign
Transcript: ENSMUST00000163382
SMART Domains Protein: ENSMUSP00000131502
Gene: ENSMUSG00000022403

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 2e-27 PDB
low complexity region 52 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163754
SMART Domains Protein: ENSMUSP00000132822
Gene: ENSMUSG00000022401

DomainStartEndE-ValueType
AMP_N 67 213 6.36e-54 SMART
Pfam:Peptidase_M24 253 481 1.1e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164144
Predicted Effect probably benign
Transcript: ENSMUST00000165258
Predicted Effect probably null
Transcript: ENSMUST00000165582
SMART Domains Protein: ENSMUSP00000129966
Gene: ENSMUSG00000022403

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 34 44 N/A INTRINSIC
Pfam:TPR_11 74 129 6.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167799
SMART Domains Protein: ENSMUSP00000126038
Gene: ENSMUSG00000022401

DomainStartEndE-ValueType
AMP_N 67 203 6.87e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169204
Predicted Effect probably benign
Transcript: ENSMUST00000172107
SMART Domains Protein: ENSMUSP00000130195
Gene: ENSMUSG00000022403

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 6e-25 PDB
low complexity region 52 66 N/A INTRINSIC
low complexity region 71 81 N/A INTRINSIC
TPR 113 146 1.2e1 SMART
TPR 147 180 6.95e-4 SMART
TPR 181 214 4.8e1 SMART
coiled coil region 234 273 N/A INTRINSIC
low complexity region 280 314 N/A INTRINSIC
STI1 321 360 3.37e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230906
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (85/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adaptor protein that mediates the association of the heat shock proteins HSP70 and HSP90. This protein has been shown to be involved in the assembly process of glucocorticoid receptor, which requires the assistance of multiple molecular chaperones. The expression of this gene is reported to be downregulated in colorectal carcinoma tissue suggesting that it is a candidate tumor suppressor gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,614 K623E probably damaging Het
A530064D06Rik T A 17: 48,152,848 S227C possibly damaging Het
Adam30 A T 3: 98,162,950 I700F probably damaging Het
Adam5 A T 8: 24,786,151 M500K probably benign Het
Adgb A T 10: 10,398,943 S755T possibly damaging Het
Adgrv1 C T 13: 81,386,005 G5819D probably damaging Het
Ank3 T A 10: 69,927,727 Y17N probably damaging Het
Ano2 A T 6: 125,992,955 M745L probably benign Het
Arap2 A G 5: 62,714,731 probably null Het
Atg2a A T 19: 6,241,729 probably benign Het
AU021092 G T 16: 5,220,448 probably null Het
Bbs1 A T 19: 4,890,721 L578Q probably damaging Het
Brd9 A T 13: 73,960,314 E589D probably damaging Het
Calr4 A G 4: 109,244,245 D108G probably benign Het
Ccdc82 A G 9: 13,272,479 D429G probably damaging Het
Cdh22 G T 2: 165,146,630 N268K probably damaging Het
Ceacam12 G A 7: 18,067,387 G97D probably damaging Het
Clcn1 A G 6: 42,314,162 D990G probably damaging Het
Cyp2c40 T C 19: 39,812,560 T84A probably benign Het
Dnah7a G A 1: 53,433,022 P3529S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Efna3 GAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGC 3: 89,322,798 probably benign Het
Ehd2 G A 7: 15,963,464 Q4* probably null Het
Eml5 A G 12: 98,794,456 V1726A possibly damaging Het
Esam A G 9: 37,528,248 T10A probably benign Het
Fam19a1 A G 6: 96,115,740 H35R probably benign Het
Fbxl6 A G 15: 76,538,433 L95P probably benign Het
Fbxw18 T A 9: 109,676,879 L441F probably damaging Het
Fbxw4 A G 19: 45,636,327 S73P probably benign Het
Fndc1 T A 17: 7,772,647 H739L unknown Het
Foxp1 G A 6: 98,966,076 T237I probably damaging Het
Gm13212 A T 4: 145,624,241 probably benign Het
Gm4969 C A 7: 19,100,889 probably benign Het
Greb1 A T 12: 16,674,770 I1801N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa13 G T 6: 52,259,928 N281K probably damaging Het
Hspg2 A G 4: 137,569,518 T4328A probably damaging Het
Htr2a C G 14: 74,645,034 Y153* probably null Het
Iglv1 C A 16: 19,085,094 A92S probably damaging Het
Itih1 A G 14: 30,931,195 S759P probably damaging Het
Kctd1 G T 18: 14,969,631 S831* probably null Het
Kif20a T A 18: 34,628,146 S265T probably damaging Het
Kif22 T A 7: 127,031,056 E436V possibly damaging Het
Kif27 A G 13: 58,311,237 W927R probably damaging Het
Lcorl G A 5: 45,776,490 P66L probably damaging Het
Lct A G 1: 128,327,714 L197P probably damaging Het
Lefty1 T C 1: 180,935,149 S14P unknown Het
Lnp1 A G 16: 56,917,492 S78P possibly damaging Het
Map3k19 A T 1: 127,822,832 H927Q probably benign Het
Mta3 A G 17: 83,791,793 T430A probably benign Het
Muc2 G T 7: 141,696,632 C627F probably damaging Het
Myh13 A G 11: 67,354,762 D1076G probably benign Het
Nck2 T A 1: 43,533,569 M1K probably null Het
Nipal1 A G 5: 72,663,555 N131S probably damaging Het
Nlrp9c T C 7: 26,378,001 probably null Het
Nr2f2 A G 7: 70,358,198 S179P probably damaging Het
Olfr1013 A T 2: 85,770,308 N169I probably benign Het
Olfr345 A G 2: 36,640,051 D4G probably benign Het
Olfr50 A T 2: 36,793,968 H244L probably damaging Het
Oxt G T 2: 130,576,243 probably benign Het
Pank2 T A 2: 131,280,261 Y235* probably null Het
Pear1 A G 3: 87,752,133 L798P possibly damaging Het
Pex14 T C 4: 148,961,699 H258R probably benign Het
Pmpcb A G 5: 21,757,033 I487V probably benign Het
Ppie T C 4: 123,137,569 E44G probably benign Het
Ppp1r9a A T 6: 4,905,639 R65* probably null Het
Ralgapb T C 2: 158,446,155 S371P probably damaging Het
Ros1 T C 10: 52,101,785 H1455R probably benign Het
Sacs C A 14: 61,212,826 T4107K possibly damaging Het
Sec24a G A 11: 51,731,891 T386M probably damaging Het
Slc10a4 A T 5: 73,012,250 Y207F possibly damaging Het
Slc30a10 T C 1: 185,455,311 L83P probably damaging Het
Slc38a9 T A 13: 112,703,559 L324* probably null Het
Slc7a9 A T 7: 35,465,852 Q474L probably damaging Het
Smc5 C A 19: 23,214,170 V875L possibly damaging Het
Snap91 T C 9: 86,825,000 R246G probably damaging Het
Sned1 A G 1: 93,275,474 probably null Het
Spink14 G A 18: 44,031,871 G85E probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stk10 A G 11: 32,603,761 M593V possibly damaging Het
Tex21 C A 12: 76,198,933 A530S probably benign Het
Tln2 T A 9: 67,224,081 K1394N probably damaging Het
Trhr2 C A 8: 122,357,379 R294L probably damaging Het
Unc79 A T 12: 103,183,449 I2408F probably damaging Het
Wdr24 T C 17: 25,826,578 L429P probably damaging Het
Wwp2 T A 8: 107,483,407 I139N possibly damaging Het
Zfp111 G A 7: 24,198,129 R686C unknown Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in St13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:St13 APN 15 81371507 missense probably damaging 0.99
IGL01933:St13 APN 15 81389698 critical splice acceptor site probably null
IGL02152:St13 APN 15 81366382 missense probably damaging 1.00
R0714:St13 UTSW 15 81383027 missense probably benign 0.16
R3417:St13 UTSW 15 81369450 splice site probably benign
R4845:St13 UTSW 15 81399585 missense probably benign 0.09
R4925:St13 UTSW 15 81399585 missense probably benign 0.09
R4934:St13 UTSW 15 81399585 missense probably benign 0.09
R5029:St13 UTSW 15 81399585 missense probably benign 0.09
R5042:St13 UTSW 15 81365492 missense probably damaging 1.00
R5048:St13 UTSW 15 81399585 missense probably benign 0.09
R5139:St13 UTSW 15 81399585 missense probably benign 0.09
R5970:St13 UTSW 15 81377798 missense probably damaging 0.99
R6158:St13 UTSW 15 81399601 unclassified probably null
R6872:St13 UTSW 15 81366346 critical splice donor site probably null
R7320:St13 UTSW 15 81389653 missense probably damaging 0.99
X0065:St13 UTSW 15 81366436 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAACGACACATGGGTCAATGC -3'
(R):5'- TGAAGATGTGTAGGCAGGACCC -3'

Sequencing Primer
(F):5'- CATGGGTCAATGCGACTTAAAC -3'
(R):5'- ACCGAGGAAATGCGCTTC -3'
Posted On2018-05-02