Incidental Mutation 'R6178:Mau2'
ID514477
Institutional Source Beutler Lab
Gene Symbol Mau2
Ensembl Gene ENSMUSG00000031858
Gene NameMAU2 sister chromatid cohesion factor
Synonyms
MMRRC Submission 044320-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6178 (G1)
Quality Score65.0073
Status Validated
Chromosome8
Chromosomal Location70016123-70042734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70042537 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 50 (I50T)
Ref Sequence ENSEMBL: ENSMUSP00000148532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011450] [ENSMUST00000050561] [ENSMUST00000168013] [ENSMUST00000212308] [ENSMUST00000212451] [ENSMUST00000212845]
Predicted Effect probably benign
Transcript: ENSMUST00000011450
SMART Domains Protein: ENSMUSP00000011450
Gene: ENSMUSG00000011306

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
SWAP 185 239 8e-20 SMART
SWAP 260 314 4.09e-17 SMART
low complexity region 344 365 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
G_patch 558 605 3.25e-17 SMART
low complexity region 628 643 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000050561
AA Change: I50T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054763
Gene: ENSMUSG00000031858
AA Change: I50T

DomainStartEndE-ValueType
Pfam:Cohesin_load 29 575 5e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168013
AA Change: I50T

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131966
Gene: ENSMUSG00000031858
AA Change: I50T

DomainStartEndE-ValueType
Pfam:Cohesin_load 29 576 8.7e-130 PFAM
Pfam:TPR_8 71 105 3.3e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212055
Predicted Effect possibly damaging
Transcript: ENSMUST00000212308
AA Change: I50T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212401
Predicted Effect possibly damaging
Transcript: ENSMUST00000212451
AA Change: I50T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000212845
AA Change: I50T

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213035
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,029,044 I61V probably benign Het
Afg3l2 G A 18: 67,409,528 T616I possibly damaging Het
Aktip T C 8: 91,126,043 N195S probably damaging Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Atg7 T A 6: 114,724,895 I621N probably damaging Het
Becn1 T A 11: 101,291,510 I283F probably damaging Het
C4b T C 17: 34,733,406 T1220A probably benign Het
Celsr1 C A 15: 85,901,021 R3004M probably benign Het
Clspn A T 4: 126,577,736 probably null Het
Csmd3 T C 15: 48,673,458 Y116C probably damaging Het
Dcp1a T G 14: 30,523,304 *603G probably null Het
Dmrtc1b C T X: 102,713,563 P205S possibly damaging Het
Fev G T 1: 74,884,539 probably benign Het
Fry T A 5: 150,454,522 V393E probably damaging Het
Gm30646 A G 7: 30,432,656 probably null Het
Gm36028 T C 16: 37,856,060 Y115C probably damaging Het
Gm3676 C T 14: 41,641,495 E175K probably benign Het
Gm4847 T C 1: 166,642,336 Y56C probably damaging Het
Gm5422 T C 10: 31,249,692 noncoding transcript Het
Gstm6 A G 3: 107,941,081 V174A probably benign Het
Isoc1 G T 18: 58,671,592 V191F possibly damaging Het
Kalrn T A 16: 34,053,639 D132V possibly damaging Het
Kcp T C 6: 29,482,888 D1394G possibly damaging Het
March10 T G 11: 105,389,614 D615A probably damaging Het
Mgp A G 6: 136,872,724 C79R probably damaging Het
Mpdz T A 4: 81,308,365 K1344N probably damaging Het
Mrgpre T A 7: 143,780,971 Y265F possibly damaging Het
Mro G A 18: 73,873,224 V80M possibly damaging Het
Mrpl44 G T 1: 79,778,178 C167F possibly damaging Het
Muc5b A G 7: 141,856,342 M1218V probably null Het
Naa16 T C 14: 79,383,340 I100V possibly damaging Het
Nup205 A T 6: 35,243,843 Y1860F possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1195 T C 2: 88,683,633 Y33C probably damaging Het
Olfr293 A G 7: 86,664,611 I316M probably benign Het
Olfr432 A T 1: 174,050,967 Y198F probably benign Het
Plcb3 A G 19: 6,954,703 probably null Het
Pnpla3 G A 15: 84,180,931 A309T probably benign Het
Ranbp10 A G 8: 105,771,664 S624P possibly damaging Het
Ripor2 T C 13: 24,710,130 S714P possibly damaging Het
Robo4 C T 9: 37,405,630 Q414* probably null Het
Shc2 A G 10: 79,630,120 I161T probably damaging Het
Slc35b2 C T 17: 45,566,376 T143I probably benign Het
Slc39a13 T C 2: 91,068,535 D77G probably damaging Het
Snx6 A C 12: 54,760,464 D243E probably damaging Het
Taar8b A G 10: 24,091,813 V161A probably benign Het
Tbr1 T A 2: 61,804,815 D36E possibly damaging Het
Tdpoz2 T C 3: 93,652,311 N118S probably benign Het
Tgfb1i1 T C 7: 128,253,345 F478L probably damaging Het
Tmprss11f T C 5: 86,556,978 D27G probably benign Het
Trim30d T G 7: 104,487,995 M1L probably damaging Het
Trpm7 A G 2: 126,837,381 V420A probably damaging Het
Ubap2 G T 4: 41,206,981 P199H probably benign Het
Ubash3b T C 9: 41,014,916 T512A probably damaging Het
Zfp65 G A 13: 67,710,318 P76S probably benign Het
Zic5 A T 14: 122,459,336 H622Q unknown Het
Zpld1 A T 16: 55,233,630 N266K probably damaging Het
Zswim1 A G 2: 164,826,052 probably null Het
Other mutations in Mau2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Mau2 APN 8 70029245 splice site probably benign
IGL02353:Mau2 APN 8 70019638 missense probably damaging 0.99
IGL02360:Mau2 APN 8 70019638 missense probably damaging 0.99
IGL02990:Mau2 APN 8 70022255 splice site probably benign
PIT4382001:Mau2 UTSW 8 70030652 missense possibly damaging 0.95
R0378:Mau2 UTSW 8 70030655 missense probably damaging 0.99
R0556:Mau2 UTSW 8 70042432 missense probably damaging 1.00
R0558:Mau2 UTSW 8 70042432 missense probably damaging 1.00
R0731:Mau2 UTSW 8 70023612 critical splice donor site probably null
R0987:Mau2 UTSW 8 70027698 missense probably damaging 0.99
R1866:Mau2 UTSW 8 70031492 missense probably damaging 1.00
R2857:Mau2 UTSW 8 70019824 missense probably benign 0.08
R4852:Mau2 UTSW 8 70033177 critical splice donor site probably null
R4893:Mau2 UTSW 8 70030640 critical splice donor site probably null
R4970:Mau2 UTSW 8 70027703 missense possibly damaging 0.94
R5004:Mau2 UTSW 8 70025887 missense probably damaging 1.00
R5012:Mau2 UTSW 8 70031457 splice site probably null
R5248:Mau2 UTSW 8 70028723 missense probably benign 0.11
R6150:Mau2 UTSW 8 70019837 missense probably benign 0.23
R6343:Mau2 UTSW 8 70031523 missense probably damaging 0.99
R6649:Mau2 UTSW 8 70031516 missense possibly damaging 0.71
R6838:Mau2 UTSW 8 70039297 splice site probably null
R6959:Mau2 UTSW 8 70033228 missense probably damaging 1.00
R7365:Mau2 UTSW 8 70029234 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCTGAAGAGGGACAACTTTCC -3'
(R):5'- AGACCCAGAAGTCCTTGCGTAG -3'

Sequencing Primer
(F):5'- GGGACAACTTTCCCGGTTC -3'
(R):5'- TCTCGCGAGAATTGCGG -3'
Posted On2018-05-04