Incidental Mutation 'R6407:Sag'
ID514479
Institutional Source Beutler Lab
Gene Symbol Sag
Ensembl Gene ENSMUSG00000056055
Gene NameS-antigen, retina and pineal gland (arrestin)
Synonymsarrestin 1, A930001K18Rik, arrestin, visual arrestin 1, Arr1, rod arrestin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87803680-87845158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87814806 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 100 (V100A)
Ref Sequence ENSEMBL: ENSMUSP00000136729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077772] [ENSMUST00000177757]
Predicted Effect probably benign
Transcript: ENSMUST00000077772
AA Change: V100A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076948
Gene: ENSMUSG00000056055
AA Change: V100A

DomainStartEndE-ValueType
Pfam:Arrestin_N 23 181 2.8e-36 PFAM
Arrestin_C 200 361 8.24e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156381
Predicted Effect probably benign
Transcript: ENSMUST00000177757
AA Change: V100A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136729
Gene: ENSMUSG00000056055
AA Change: V100A

DomainStartEndE-ValueType
Pfam:Arrestin_N 23 181 2.7e-34 PFAM
Arrestin_C 200 361 8.24e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. S-arrestin, also known as S-antigen, is a major soluble photoreceptor protein that is involved in desensitization of the photoactivated transduction cascade. It is expressed in the retina and the pineal gland and inhibits coupling of rhodopsin to transducin in vitro. Additionally, S-arrestin is highly antigenic, and is capable of inducing experimental autoimmune uveoretinitis. Mutations in this gene have been associated with Oguchi disease, a rare autosomal recessive form of night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in retinal rod cell outer segment morphology and rod electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Sag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Sag APN 1 87824424 critical splice acceptor site probably null
IGL00822:Sag APN 1 87845026 unclassified probably null
IGL01140:Sag APN 1 87823364 missense probably benign 0.22
IGL01612:Sag APN 1 87805349 missense probably damaging 0.98
IGL02183:Sag APN 1 87828475 splice site probably null
IGL02893:Sag APN 1 87834593 missense probably benign 0.01
R0049:Sag UTSW 1 87834618 missense probably damaging 0.99
R0049:Sag UTSW 1 87834618 missense probably damaging 0.99
R0091:Sag UTSW 1 87814680 missense probably damaging 0.96
R0531:Sag UTSW 1 87834629 critical splice donor site probably null
R0609:Sag UTSW 1 87812991 missense probably damaging 0.98
R1328:Sag UTSW 1 87810294 splice site probably benign
R1395:Sag UTSW 1 87828441 missense probably benign 0.01
R1748:Sag UTSW 1 87831940 missense probably damaging 1.00
R1858:Sag UTSW 1 87814848 missense probably benign
R2020:Sag UTSW 1 87805315 missense probably damaging 1.00
R3854:Sag UTSW 1 87824518 splice site probably benign
R4021:Sag UTSW 1 87821305 critical splice acceptor site probably null
R4298:Sag UTSW 1 87845015 missense probably benign
R4630:Sag UTSW 1 87834618 missense probably damaging 0.99
R5352:Sag UTSW 1 87812993 missense probably benign 0.01
R5680:Sag UTSW 1 87821337 missense possibly damaging 0.83
R6164:Sag UTSW 1 87824453 missense probably damaging 1.00
R7431:Sag UTSW 1 87821337 missense possibly damaging 0.83
R7548:Sag UTSW 1 87844916 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTAGCTCCATCCAGTGAAAG -3'
(R):5'- GGTGCAATTTACAGGCCAAC -3'

Sequencing Primer
(F):5'- TCCATCCAGTGAAAGTGGCTG -3'
(R):5'- TGCAATTTACAGGCCAACAGATGTG -3'
Posted On2018-05-04