Incidental Mutation 'R6407:Il1f5'
ID514481
Institutional Source Beutler Lab
Gene Symbol Il1f5
Ensembl Gene ENSMUSG00000026983
Gene Nameinterleukin 1 family, member 5 (delta)
SynonymsFIL1delta, IL-1H3, IL1HY1, IL1F5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location24276954-24283426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24281353 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 151 (Y151C)
Ref Sequence ENSEMBL: ENSMUSP00000126028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028360] [ENSMUST00000114490] [ENSMUST00000123053] [ENSMUST00000147885] [ENSMUST00000168941]
Predicted Effect probably damaging
Transcript: ENSMUST00000028360
AA Change: Y151C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028360
Gene: ENSMUSG00000026983
AA Change: Y151C

DomainStartEndE-ValueType
IL1 5 153 7.96e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114490
AA Change: Y151C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110134
Gene: ENSMUSG00000026983
AA Change: Y151C

DomainStartEndE-ValueType
IL1 5 153 7.96e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123053
SMART Domains Protein: ENSMUSP00000116122
Gene: ENSMUSG00000026983

DomainStartEndE-ValueType
PDB:1MD6|A 3 72 5e-45 PDB
Blast:IL1 5 72 1e-42 BLAST
SCOP:d1ilr1_ 10 71 1e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123577
Predicted Effect probably benign
Transcript: ENSMUST00000147885
SMART Domains Protein: ENSMUSP00000141512
Gene: ENSMUSG00000026983

DomainStartEndE-ValueType
PDB:1MD6|A 3 82 2e-52 PDB
Blast:IL1 5 82 3e-50 BLAST
SCOP:d1ilr1_ 10 82 2e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168941
AA Change: Y151C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126028
Gene: ENSMUSG00000026983
AA Change: Y151C

DomainStartEndE-ValueType
IL1 5 153 7.96e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195464
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine was shown to specifically inhibit the activation of NF-kappaB induced by interleukin 1 family, member 6 (IL1F6). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are overtly normal with no apparent histopathological abnormalities or immune cell alterations. Mice homozygous for a knock-out allele exhibit increased sensitivity to IMQ-induced psoriasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Il1f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2004:Il1f5 UTSW 2 24281364 missense probably damaging 1.00
R2162:Il1f5 UTSW 2 24279680 missense probably damaging 0.98
R2190:Il1f5 UTSW 2 24280819 missense probably damaging 1.00
R3737:Il1f5 UTSW 2 24281203 missense probably damaging 1.00
R4740:Il1f5 UTSW 2 24277491 utr 5 prime probably benign
R4867:Il1f5 UTSW 2 24280835 missense probably damaging 1.00
R5908:Il1f5 UTSW 2 24277490 start gained probably benign
R6218:Il1f5 UTSW 2 24277490 start gained probably benign
R6347:Il1f5 UTSW 2 24279714 missense probably damaging 1.00
R6348:Il1f5 UTSW 2 24279714 missense probably damaging 1.00
R7067:Il1f5 UTSW 2 24277529 nonsense probably null
R7403:Il1f5 UTSW 2 24281202 missense probably damaging 1.00
R7477:Il1f5 UTSW 2 24279692 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCAGTGAACATCATGGAGC -3'
(R):5'- ACCAGAAGATTTACCAGCACTG -3'

Sequencing Primer
(F):5'- GTGAACATCATGGAGCTCTACCTCG -3'
(R):5'- GAGAAGAGAGTGTCTGTGTGCC -3'
Posted On2018-05-04