Incidental Mutation 'R6407:Zcchc11'
ID514485
Institutional Source Beutler Lab
Gene Symbol Zcchc11
Ensembl Gene ENSMUSG00000034610
Gene Namezinc finger, CCHC domain containing 11
Synonyms6030404K05Rik, 9230115F04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108459426-108559421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108558782 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1648 (E1648D)
Ref Sequence ENSEMBL: ENSMUSP00000095538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043368] [ENSMUST00000097925] [ENSMUST00000128042]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043368
AA Change: E1644D

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044836
Gene: ENSMUSG00000034610
AA Change: E1644D

DomainStartEndE-ValueType
low complexity region 260 275 N/A INTRINSIC
SCOP:d1f5aa2 363 569 2e-23 SMART
Pfam:PAP_assoc 648 701 1.2e-13 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 815 828 N/A INTRINSIC
ZnF_C2HC 931 947 7.79e-3 SMART
Pfam:NTP_transf_2 995 1085 4.2e-10 PFAM
Pfam:PAP_assoc 1201 1254 4.7e-19 PFAM
ZnF_C2HC 1311 1327 3.83e-3 SMART
ZnF_C2HC 1359 1375 3.44e-4 SMART
low complexity region 1398 1412 N/A INTRINSIC
low complexity region 1418 1473 N/A INTRINSIC
low complexity region 1628 1639 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097925
AA Change: E1648D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095538
Gene: ENSMUSG00000034610
AA Change: E1648D

DomainStartEndE-ValueType
low complexity region 260 275 N/A INTRINSIC
SCOP:d1f5aa2 363 569 2e-23 SMART
Pfam:PAP_assoc 648 701 8e-14 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 815 828 N/A INTRINSIC
ZnF_C2HC 931 947 7.79e-3 SMART
Pfam:NTP_transf_2 994 1082 6.3e-11 PFAM
Pfam:PAP_assoc 1201 1254 5.2e-19 PFAM
ZnF_C2HC 1311 1327 3.83e-3 SMART
ZnF_C2HC 1364 1380 3.44e-4 SMART
low complexity region 1403 1417 N/A INTRINSIC
low complexity region 1423 1478 N/A INTRINSIC
low complexity region 1632 1643 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127602
Predicted Effect possibly damaging
Transcript: ENSMUST00000128042
AA Change: E105D

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116253
Gene: ENSMUSG00000034610
AA Change: E105D

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145590
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZCCHC11 is an RNA uridyltransferase (EC 2.7.7.52) that uses UTP to add uridines to the 3-prime end of substrate RNA molecules (Jones et al., 2009 [PubMed 19701194]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial postnatal lethality associated with postnatal growth retardation and reduced circulating insulin-like growth factor I levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Zcchc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zcchc11 APN 4 108550728 missense probably damaging 1.00
IGL00684:Zcchc11 APN 4 108479466 missense possibly damaging 0.80
IGL01598:Zcchc11 APN 4 108550820 unclassified probably benign
IGL01599:Zcchc11 APN 4 108513399 missense possibly damaging 0.85
IGL02088:Zcchc11 APN 4 108512218 splice site probably benign
IGL02451:Zcchc11 APN 4 108529276 nonsense probably null
IGL02667:Zcchc11 APN 4 108558708 splice site probably benign
IGL03080:Zcchc11 APN 4 108505824 missense probably damaging 1.00
IGL03374:Zcchc11 APN 4 108558777 missense probably damaging 1.00
H8786:Zcchc11 UTSW 4 108550815 critical splice donor site probably null
IGL02799:Zcchc11 UTSW 4 108513528 missense probably benign
R0013:Zcchc11 UTSW 4 108530955 splice site probably benign
R0013:Zcchc11 UTSW 4 108530955 splice site probably benign
R0051:Zcchc11 UTSW 4 108527004 missense probably damaging 1.00
R0051:Zcchc11 UTSW 4 108527004 missense probably damaging 1.00
R0410:Zcchc11 UTSW 4 108486555 missense probably benign 0.27
R0698:Zcchc11 UTSW 4 108555533 missense probably benign 0.22
R0745:Zcchc11 UTSW 4 108502955 splice site probably benign
R1080:Zcchc11 UTSW 4 108479499 missense possibly damaging 0.82
R1774:Zcchc11 UTSW 4 108507955 missense probably damaging 1.00
R1809:Zcchc11 UTSW 4 108549355 missense probably damaging 1.00
R1869:Zcchc11 UTSW 4 108529300 missense probably damaging 1.00
R1874:Zcchc11 UTSW 4 108550725 missense probably damaging 1.00
R1958:Zcchc11 UTSW 4 108555706 missense probably damaging 1.00
R1976:Zcchc11 UTSW 4 108479523 missense probably benign 0.01
R2034:Zcchc11 UTSW 4 108512195 missense probably damaging 1.00
R2164:Zcchc11 UTSW 4 108503029 missense possibly damaging 0.73
R2251:Zcchc11 UTSW 4 108520208 missense probably damaging 1.00
R3001:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R3002:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R3003:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R4170:Zcchc11 UTSW 4 108548059 missense probably damaging 1.00
R4667:Zcchc11 UTSW 4 108495159 missense probably damaging 1.00
R4868:Zcchc11 UTSW 4 108549220 splice site probably benign
R4989:Zcchc11 UTSW 4 108526845 unclassified probably benign
R5014:Zcchc11 UTSW 4 108526846 unclassified probably benign
R5118:Zcchc11 UTSW 4 108520292 missense possibly damaging 0.92
R5431:Zcchc11 UTSW 4 108491412 missense probably damaging 1.00
R5645:Zcchc11 UTSW 4 108557373 missense probably damaging 1.00
R5661:Zcchc11 UTSW 4 108513187 missense probably benign 0.05
R5877:Zcchc11 UTSW 4 108512923 missense probably damaging 0.99
R6307:Zcchc11 UTSW 4 108555620 missense probably damaging 1.00
R6326:Zcchc11 UTSW 4 108478980 missense probably benign 0.02
R6493:Zcchc11 UTSW 4 108526805 missense probably damaging 1.00
R6587:Zcchc11 UTSW 4 108479449 missense probably benign
R7215:Zcchc11 UTSW 4 108527008 missense probably damaging 1.00
R7413:Zcchc11 UTSW 4 108549336 missense possibly damaging 0.69
R7584:Zcchc11 UTSW 4 108479346 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGTGTGAGGTTCTTTCCC -3'
(R):5'- TGGCACTACAAGGTTCTGTAAAG -3'

Sequencing Primer
(F):5'- TTCCTCCAAATGTTGTTATGTGG -3'
(R):5'- GTCTGAAGCAACCAAAGTATGAATAC -3'
Posted On2018-05-04