Incidental Mutation 'R6407:Lap3'
ID514487
Institutional Source Beutler Lab
Gene Symbol Lap3
Ensembl Gene ENSMUSG00000039682
Gene Nameleucine aminopeptidase 3
SynonymsPep-7, LAP, peptidase S, Pep-S, Pep7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location45493374-45512691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45511925 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 472 (V472E)
Ref Sequence ENSEMBL: ENSMUSP00000040222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046122]
Predicted Effect probably damaging
Transcript: ENSMUST00000046122
AA Change: V472E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040222
Gene: ENSMUSG00000039682
AA Change: V472E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:Peptidase_M17_N 37 169 1.5e-21 PFAM
Pfam:Peptidase_M17 197 508 1.3e-119 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146811
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no detectable abnormalities in generating peptides presented by MHC class I under constitutive conditions or after stimulation with IFN. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Lap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lap3 APN 5 45506169 unclassified probably benign
IGL00945:Lap3 APN 5 45504773 unclassified probably null
IGL01694:Lap3 APN 5 45498595 critical splice donor site probably null
IGL02427:Lap3 APN 5 45511133 missense probably damaging 0.99
IGL02751:Lap3 APN 5 45504796 missense probably damaging 1.00
R0110:Lap3 UTSW 5 45495290 splice site probably benign
R0666:Lap3 UTSW 5 45511928 missense possibly damaging 0.53
R1023:Lap3 UTSW 5 45495211 missense probably benign 0.04
R1157:Lap3 UTSW 5 45507148 missense probably damaging 1.00
R1294:Lap3 UTSW 5 45498521 missense probably benign 0.03
R1449:Lap3 UTSW 5 45509519 critical splice donor site probably null
R1869:Lap3 UTSW 5 45503387 missense probably benign 0.00
R1900:Lap3 UTSW 5 45511910 missense probably damaging 1.00
R1971:Lap3 UTSW 5 45506166 unclassified probably benign
R2009:Lap3 UTSW 5 45493557 missense probably benign 0.37
R4171:Lap3 UTSW 5 45509491 missense probably benign 0.45
R4708:Lap3 UTSW 5 45511138 missense probably damaging 1.00
R4941:Lap3 UTSW 5 45506197 missense probably benign 0.19
R5558:Lap3 UTSW 5 45504751 missense probably benign 0.00
R5761:Lap3 UTSW 5 45504805 missense probably benign 0.01
R5893:Lap3 UTSW 5 45511279 intron probably benign
R7144:Lap3 UTSW 5 45496948 missense probably benign 0.00
R7161:Lap3 UTSW 5 45498467 missense probably benign 0.23
R7489:Lap3 UTSW 5 45500506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATATGCCATGGTCCTGTG -3'
(R):5'- CCAATTCAAGACAGATGGAGTAATC -3'

Sequencing Primer
(F):5'- TGTGTTCCAGAGACAGCTCAG -3'
(R):5'- TCTGTGAGTGAACTAAGAACTGTC -3'
Posted On2018-05-04