Incidental Mutation 'R6407:Srgap3'
ID514489
Institutional Source Beutler Lab
Gene Symbol Srgap3
Ensembl Gene ENSMUSG00000030257
Gene NameSLIT-ROBO Rho GTPase activating protein 3
SynonymsD130026O08Rik, Arhgap14
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location112717971-112947266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112723006 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1004 (S1004G)
Ref Sequence ENSEMBL: ENSMUSP00000108794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088373] [ENSMUST00000113169]
Predicted Effect probably damaging
Transcript: ENSMUST00000088373
AA Change: S1028G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085712
Gene: ENSMUSG00000030257
AA Change: S1028G

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
RhoGAP 517 691 7.43e-66 SMART
SH3 747 802 9.69e-15 SMART
coiled coil region 955 985 N/A INTRINSIC
low complexity region 1025 1038 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113169
AA Change: S1004G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108794
Gene: ENSMUSG00000030257
AA Change: S1004G

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
Blast:RhoGAP 434 474 4e-11 BLAST
low complexity region 476 488 N/A INTRINSIC
RhoGAP 493 667 7.43e-66 SMART
SH3 723 778 9.69e-15 SMART
coiled coil region 931 961 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in spine density in the brain CA1 and cortical layers IV/V. Mice homozygous for a different knock-out allele exhibit a neurodevelopment disorder with schizophrenia-related intermediate phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Srgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Srgap3 APN 6 112739397 missense probably damaging 0.98
IGL01325:Srgap3 APN 6 112775686 missense probably damaging 1.00
IGL01608:Srgap3 APN 6 112946478 missense probably benign 0.00
IGL01626:Srgap3 APN 6 112773648 missense probably damaging 0.98
IGL01787:Srgap3 APN 6 112723022 missense probably benign 0.00
IGL02698:Srgap3 APN 6 112746928 missense probably damaging 0.98
IGL02805:Srgap3 APN 6 112727263 missense probably damaging 0.99
IGL02813:Srgap3 APN 6 112731480 missense probably damaging 1.00
IGL02876:Srgap3 APN 6 112771453 missense probably damaging 1.00
IGL03264:Srgap3 APN 6 112816675 missense probably damaging 1.00
IGL03342:Srgap3 APN 6 112775687 missense probably damaging 1.00
R0007:Srgap3 UTSW 6 112829512 missense probably damaging 1.00
R0371:Srgap3 UTSW 6 112771471 missense probably damaging 0.99
R0607:Srgap3 UTSW 6 112723119 missense probably damaging 1.00
R1628:Srgap3 UTSW 6 112739370 missense probably damaging 0.99
R1669:Srgap3 UTSW 6 112722904 missense probably benign 0.36
R1858:Srgap3 UTSW 6 112771518 missense probably damaging 1.00
R1876:Srgap3 UTSW 6 112775566 missense probably damaging 0.98
R1896:Srgap3 UTSW 6 112738997 missense probably benign 0.11
R2159:Srgap3 UTSW 6 112771378 missense probably damaging 0.99
R2221:Srgap3 UTSW 6 112946493 missense probably damaging 0.98
R2862:Srgap3 UTSW 6 112722972 missense probably damaging 0.99
R3160:Srgap3 UTSW 6 112729658 missense probably benign 0.00
R3162:Srgap3 UTSW 6 112729658 missense probably benign 0.00
R4092:Srgap3 UTSW 6 112723084 missense probably benign 0.00
R4561:Srgap3 UTSW 6 112781054 missense probably damaging 0.98
R4781:Srgap3 UTSW 6 112757425 intron probably benign
R4825:Srgap3 UTSW 6 112727310 missense probably benign
R4887:Srgap3 UTSW 6 112746934 missense probably damaging 1.00
R5304:Srgap3 UTSW 6 112766939 missense probably damaging 1.00
R5556:Srgap3 UTSW 6 112739078 missense probably damaging 0.99
R5672:Srgap3 UTSW 6 112775561 missense probably benign
R5879:Srgap3 UTSW 6 112722846 missense possibly damaging 0.67
R5944:Srgap3 UTSW 6 112795814 missense possibly damaging 0.89
R6277:Srgap3 UTSW 6 112739383 missense probably benign 0.02
R6298:Srgap3 UTSW 6 112816610 missense probably damaging 0.98
R6408:Srgap3 UTSW 6 112723006 missense probably damaging 0.99
R6797:Srgap3 UTSW 6 112829542 missense probably damaging 1.00
R6852:Srgap3 UTSW 6 112816661 missense probably damaging 1.00
R6965:Srgap3 UTSW 6 112723129 missense probably damaging 1.00
R7055:Srgap3 UTSW 6 112746963 missense probably damaging 0.97
R7067:Srgap3 UTSW 6 112757305 intron probably benign
R7361:Srgap3 UTSW 6 112746921 missense probably damaging 0.99
R7479:Srgap3 UTSW 6 112735833 critical splice donor site probably null
R7606:Srgap3 UTSW 6 112739376 missense probably benign 0.00
R7731:Srgap3 UTSW 6 112766897 missense probably benign 0.36
R7787:Srgap3 UTSW 6 112775559 missense probably benign 0.02
R7990:Srgap3 UTSW 6 112739427 splice site probably null
R8026:Srgap3 UTSW 6 112739364
R8040:Srgap3 UTSW 6 112739364
R8066:Srgap3 UTSW 6 112771378 missense probably damaging 0.99
R8067:Srgap3 UTSW 6 112739364
X0062:Srgap3 UTSW 6 112795786 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTGTCCGAGGAGCTATTAGG -3'
(R):5'- ACATCGAGAAGACCATGAGC -3'

Sequencing Primer
(F):5'- GGAGCTATTAGGGAACATCTTCTCC -3'
(R):5'- CACCGCTCTGCATGAGTTG -3'
Posted On2018-05-04