Incidental Mutation 'R6407:Slc17a7'
ID514491
Institutional Source Beutler Lab
Gene Symbol Slc17a7
Ensembl Gene ENSMUSG00000070570
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
Synonyms2900052E22Rik, Vglut1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45163949-45176142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45169926 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 167 (A167V)
Ref Sequence ENSEMBL: ENSMUSP00000147661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085374] [ENSMUST00000209634]
Predicted Effect probably benign
Transcript: ENSMUST00000085374
AA Change: A142V

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082489
Gene: ENSMUSG00000070570
AA Change: A142V

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:MFS_1 68 453 9.3e-49 PFAM
transmembrane domain 468 490 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
low complexity region 550 556 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197423
Predicted Effect probably benign
Transcript: ENSMUST00000209634
AA Change: A167V

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211652
Meta Mutation Damage Score 0.2617 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a vesicle-bound, sodium-dependent phosphate transporter that is specifically expressed in the neuron-rich regions of the brain. It is preferentially associated with the membranes of synaptic vesicles and functions in glutamate transport. The protein shares 82% identity with the differentiation-associated Na-dependent inorganic phosphate cotransporter and they appear to form a distinct class within the Na+/Pi cotransporter family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are small and fail to thrive by 3-4 weeks of age. Abnormal excitatory post synaptic potential and currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Slc17a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02208:Slc17a7 APN 7 45170943 missense probably damaging 1.00
IGL02536:Slc17a7 APN 7 45170946 missense probably damaging 1.00
IGL03057:Slc17a7 APN 7 45170939 missense probably damaging 0.98
R0081:Slc17a7 UTSW 7 45174947 missense probably benign 0.00
R1188:Slc17a7 UTSW 7 45169887 missense possibly damaging 0.80
R1713:Slc17a7 UTSW 7 45170304 missense probably benign 0.05
R2512:Slc17a7 UTSW 7 45168864 missense probably damaging 1.00
R3915:Slc17a7 UTSW 7 45168720 missense probably damaging 0.97
R3972:Slc17a7 UTSW 7 45169910 missense possibly damaging 0.46
R4727:Slc17a7 UTSW 7 45172934 missense possibly damaging 0.64
R4761:Slc17a7 UTSW 7 45170984 missense probably benign
R6047:Slc17a7 UTSW 7 45173406 missense probably benign 0.07
R6113:Slc17a7 UTSW 7 45174751 missense possibly damaging 0.67
R6792:Slc17a7 UTSW 7 45174875 missense possibly damaging 0.50
R7404:Slc17a7 UTSW 7 45172930 missense probably benign 0.32
R8001:Slc17a7 UTSW 7 45168788 missense not run
X0067:Slc17a7 UTSW 7 45170272 missense possibly damaging 0.94
Z1177:Slc17a7 UTSW 7 45172927 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAGCTAAGTCTATGGGTGC -3'
(R):5'- AGCCATGCCAGTTATAGTGAGG -3'

Sequencing Primer
(F):5'- AGCTAAGTCTATGGGTGCTGATTG -3'
(R):5'- CCATGCCAGTTATAGTGAGGTGTTC -3'
Posted On2018-05-04