Incidental Mutation 'R6407:Olfr307'
ID514493
Institutional Source Beutler Lab
Gene Symbol Olfr307
Ensembl Gene ENSMUSG00000055610
Gene Nameolfactory receptor 307
SynonymsMOR219-1, GA_x6K02T2NHDJ-9772012-9772953
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86332176-86337586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86336069 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 109 (E109G)
Ref Sequence ENSEMBL: ENSMUSP00000149779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069279] [ENSMUST00000213705] [ENSMUST00000217494]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069279
AA Change: E109G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063538
Gene: ENSMUSG00000055610
AA Change: E109G

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:7tm_4 29 306 1.6e-42 PFAM
Pfam:7tm_1 39 288 9.8e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213705
AA Change: E109G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217494
AA Change: E109G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.3608 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Olfr307
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Olfr307 APN 7 86336061 missense probably benign 0.00
IGL02419:Olfr307 APN 7 86335662 missense probably damaging 0.98
IGL02519:Olfr307 APN 7 86335581 missense probably benign 0.01
IGL02750:Olfr307 APN 7 86335544 missense probably damaging 1.00
R0123:Olfr307 UTSW 7 86335595 missense probably benign 0.02
R0134:Olfr307 UTSW 7 86335595 missense probably benign 0.02
R0225:Olfr307 UTSW 7 86335595 missense probably benign 0.02
R1025:Olfr307 UTSW 7 86335905 missense probably benign 0.09
R1511:Olfr307 UTSW 7 86336345 missense possibly damaging 0.49
R1674:Olfr307 UTSW 7 86335557 missense probably damaging 1.00
R2011:Olfr307 UTSW 7 86335747 nonsense probably null
R4588:Olfr307 UTSW 7 86335644 missense probably benign 0.00
R5637:Olfr307 UTSW 7 86335604 missense probably benign 0.00
R6163:Olfr307 UTSW 7 86336384 missense possibly damaging 0.84
R7342:Olfr307 UTSW 7 86336087 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATGGAAAATGTGCCAGC -3'
(R):5'- CTTGGGATATACCTGGAAGCCC -3'

Sequencing Primer
(F):5'- CCAGCTGTGTATATGGCTCCAAAAAG -3'
(R):5'- TTGGGATATACCTGGAAGCCCTAATG -3'
Posted On2018-05-04