Incidental Mutation 'R6407:Kif22'
ID514495
Institutional Source Beutler Lab
Gene Symbol Kif22
Ensembl Gene ENSMUSG00000030677
Gene Namekinesin family member 22
SynonymsKid, Kif22a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127027729-127042471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127033203 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 312 (R312C)
Ref Sequence ENSEMBL: ENSMUSP00000032915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032915] [ENSMUST00000205806]
Predicted Effect probably damaging
Transcript: ENSMUST00000032915
AA Change: R312C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032915
Gene: ENSMUSG00000030677
AA Change: R312C

DomainStartEndE-ValueType
KISc 36 371 1.12e-140 SMART
low complexity region 399 428 N/A INTRINSIC
coiled coil region 460 496 N/A INTRINSIC
HhH1 597 616 2.16e0 SMART
HhH1 627 646 8.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205754
Predicted Effect probably benign
Transcript: ENSMUST00000205806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206924
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. The C-terminal half of this protein has been shown to bind DNA. Studies with the Xenopus homolog suggests its essential role in metaphase chromosome alignment and maintenance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to implantation due to defective meiosis II and early embryo mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Kif22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Kif22 APN 7 127033473 missense probably damaging 0.96
IGL01333:Kif22 APN 7 127034195 missense probably damaging 1.00
R0207:Kif22 UTSW 7 127042400 start codon destroyed probably null 0.73
R0723:Kif22 UTSW 7 127033906 missense probably damaging 1.00
R1118:Kif22 UTSW 7 127032744 missense probably benign
R1521:Kif22 UTSW 7 127027839 missense probably damaging 0.99
R2036:Kif22 UTSW 7 127030954 missense possibly damaging 0.94
R2092:Kif22 UTSW 7 127033630 missense probably damaging 0.99
R3790:Kif22 UTSW 7 127029496 missense probably damaging 1.00
R4587:Kif22 UTSW 7 127032880 critical splice donor site probably null
R4667:Kif22 UTSW 7 127033328 missense probably damaging 1.00
R5082:Kif22 UTSW 7 127033377 missense possibly damaging 0.71
R5853:Kif22 UTSW 7 127033367 missense possibly damaging 0.92
R6045:Kif22 UTSW 7 127031078 missense probably benign 0.00
R6175:Kif22 UTSW 7 127031056 missense possibly damaging 0.53
R6195:Kif22 UTSW 7 127028959 missense probably damaging 0.99
R6416:Kif22 UTSW 7 127028932 missense possibly damaging 0.95
R6561:Kif22 UTSW 7 127031053 missense probably benign 0.38
R7122:Kif22 UTSW 7 127032978 missense probably benign 0.01
R7644:Kif22 UTSW 7 127032962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATGAGGATGCTATGAGCTG -3'
(R):5'- CCTAGGTAGATCAGCGTGAACG -3'

Sequencing Primer
(F):5'- AGGATGCTATGAGCTGAGCCTC -3'
(R):5'- AGATCAGCGTGAACGTTTGACTC -3'
Posted On2018-05-04