Mutagenetix > Incidental Mutation

Incidental Mutation 'R6407:Mast3'

514496

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6407 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70782128 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 762 (T762A)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000166004
AA Change: T778A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: T778A

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

probably benign
Transcript: ENSMUST00000211948
AA Change: T762A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

unknown
Transcript: ENSMUST00000212140
AA Change: T13A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

100% (36/36)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	G	10: 82,293,811	S1122P	probably benign	Het
Alpk2	T	C	18: 65,289,738	Y1963C	probably benign	Het
Bptf	T	A	11: 107,111,126	N387Y	probably damaging	Het
C1ql2	T	C	1: 120,341,611	L165P	probably damaging	Het
Col5a2	C	A	1: 45,376,778	C1403F	probably damaging	Het
Gab1	C	A	8: 80,788,597	R364L	possibly damaging	Het
Htr3a	G	T	9: 48,901,055	Y250*	probably null	Het
Ighg2c	T	C	12: 113,288,651	K94E	unknown	Het
Ighg3	T	C	12: 113,360,150	N206S	unknown	Het
Il1f5	A	G	2: 24,281,353	Y151C	probably damaging	Het
Kif22	G	A	7: 127,033,203	R312C	probably damaging	Het
Lap3	T	A	5: 45,511,925	V472E	probably damaging	Het
Mfsd12	T	C	10: 81,362,233		probably null	Het
Mrpl39	T	C	16: 84,732,385	K123R	probably benign	Het
Mup8	T	A	4: 60,220,394	T113S	possibly damaging	Het
Nhp2	T	C	11: 51,619,903	V29A	probably benign	Het
Olfr307	T	C	7: 86,336,069	E109G	possibly damaging	Het
Pex3	T	C	10: 13,546,368	R63G	probably damaging	Het
Pfkl	A	G	10: 77,988,673		probably null	Het
Rims2	T	C	15: 39,452,328	S617P	probably damaging	Het
Rnf223	A	T	4: 156,132,359	T64S	probably damaging	Het
Rrp12	C	T	19: 41,883,742	V432M	probably damaging	Het
Sag	T	C	1: 87,814,806	V100A	probably benign	Het
Slc17a7	C	T	7: 45,169,926	A167V	probably benign	Het
Slc38a6	T	C	12: 73,310,175	F115S	probably damaging	Het
Spdye4a	T	C	5: 143,225,699	T37A	probably benign	Het
Sphk2	T	C	7: 45,712,600	T138A	possibly damaging	Het
Srgap3	T	C	6: 112,723,006	S1004G	probably damaging	Het
Sult1a1	T	C	7: 126,673,184		probably null	Het
Tmem212	A	G	3: 27,884,839	V166A	probably benign	Het
Tor4a	A	G	2: 25,194,940	L317P	probably benign	Het
Trim43c	A	T	9: 88,840,414	T38S	probably benign	Het
Tshz1	C	A	18: 84,015,966	V106F	possibly damaging	Het
Yap1	A	G	9: 7,962,372	M225T	possibly damaging	Het
Zcchc11	G	T	4: 108,558,782	E1648D	probably damaging	Het
Zfp74	T	C	7: 29,935,623	E220G	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCCAGAATGAAGACAGGCTTTTG -3'
(R):5'- ACAGGGTTTCTCTGTATAGCCC -3'

Sequencing Primer
(F):5'- AGACAGGCTTTTGGGGATCAGC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'

Posted On

2018-05-04