Incidental Mutation 'R6407:Yap1'
ID514498
Institutional Source Beutler Lab
Gene Symbol Yap1
Ensembl Gene ENSMUSG00000053110
Gene Nameyes-associated protein 1
SynonymsYki, Yap, yorkie
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location7931999-8004596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7962372 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 225 (M225T)
Ref Sequence ENSEMBL: ENSMUSP00000083772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065353] [ENSMUST00000086580] [ENSMUST00000173085] [ENSMUST00000173264] [ENSMUST00000174577]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065353
AA Change: M225T

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069554
Gene: ENSMUSG00000053110
AA Change: M225T

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 4e-68 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 316 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086580
AA Change: M225T

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083772
Gene: ENSMUSG00000053110
AA Change: M225T

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 3e-68 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173085
AA Change: M225T

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134007
Gene: ENSMUSG00000053110
AA Change: M225T

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 2e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173264
AA Change: M225T

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134237
Gene: ENSMUSG00000053110
AA Change: M225T

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 3e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174127
Predicted Effect probably benign
Transcript: ENSMUST00000174577
AA Change: M225T

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133959
Gene: ENSMUSG00000053110
AA Change: M225T

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 2e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174604
AA Change: M131T
SMART Domains Protein: ENSMUSP00000134250
Gene: ENSMUSG00000053110
AA Change: M131T

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
WW 64 96 5.63e-12 SMART
WW 123 155 8.66e-13 SMART
coiled coil region 191 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174760
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes a protein which binds to the SH3 domain of the Yes proto-oncogene product, a tyrosine kinase. This protein contains a WW domain, consisting of four conserved aromatic amino acids including two tryptophan residues. This conserved WW domain is found in various structural, regulatory and signaling molecules in various species, and may play a role in protein-protein interaction. Following cellular damage, phosphorylation of this encoded protein may suppress apoptosis. This protein may be involved in malignant transformation in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Embryos homozygous for a null mutation of this gene die between embryonic days E9.5 and E10.5 due to yolk sac avasculogenesis and failure of attachment between the allantois and the chorion. Heterozygous mice are viable, appear normal and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Yap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Yap1 APN 9 7934741 splice site probably benign
IGL01404:Yap1 APN 9 7934741 splice site probably benign
IGL02338:Yap1 APN 9 7962281 critical splice donor site probably null
IGL02398:Yap1 APN 9 7950535 missense probably benign 0.06
IGL02793:Yap1 APN 9 7973906 missense probably benign 0.44
Puddel_hunde UTSW 9 8004284 missense probably damaging 1.00
R0410:Yap1 UTSW 9 8001467 missense probably damaging 1.00
R1507:Yap1 UTSW 9 7953140 splice site probably benign
R1837:Yap1 UTSW 9 7962349 missense probably damaging 1.00
R3968:Yap1 UTSW 9 7973876 missense probably damaging 1.00
R3978:Yap1 UTSW 9 8004284 missense probably damaging 1.00
R4111:Yap1 UTSW 9 7938431 makesense probably null
R4113:Yap1 UTSW 9 7938431 makesense probably null
R4573:Yap1 UTSW 9 7934681 missense probably damaging 1.00
R5028:Yap1 UTSW 9 8001689 missense probably benign 0.05
R6397:Yap1 UTSW 9 8001466 missense probably damaging 1.00
R7743:Yap1 UTSW 9 7962378 missense probably benign 0.04
X0020:Yap1 UTSW 9 7938435 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGTTGGGTATACAGCATTTGC -3'
(R):5'- TAATCAGTTAGGTGGCCCTGC -3'

Sequencing Primer
(F):5'- GCTACTAAAGGTGTTGCAGATTC -3'
(R):5'- GCCTTATTTTCTCTTACATAGGCTG -3'
Posted On2018-05-04