Incidental Mutation 'R6407:Htr3a'
ID514499
Institutional Source Beutler Lab
Gene Symbol Htr3a
Ensembl Gene ENSMUSG00000032269
Gene Name5-hydroxytryptamine (serotonin) receptor 3A
Synonyms5-HT3 receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location48899213-48911099 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 48901055 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 250 (Y250*)
Ref Sequence ENSEMBL: ENSMUSP00000150647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003826] [ENSMUST00000217289]
Predicted Effect probably null
Transcript: ENSMUST00000003826
AA Change: Y250*
SMART Domains Protein: ENSMUSP00000003826
Gene: ENSMUSG00000032269
AA Change: Y250*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:Neur_chan_LBD 40 247 4.7e-57 PFAM
Pfam:Neur_chan_memb 254 480 1.8e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216896
Predicted Effect probably null
Transcript: ENSMUST00000217289
AA Change: Y250*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit A of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It appears that the heteromeric combination of A and B subunits is necessary to provide the full functional features of this receptor, since either subunit alone results in receptors with very low conductance and response amplitude. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display a decreased lifespan, cachexia, increased blood urea nitrogen, proteinuria, kidney inflammation, and a hyperdistended and neurogenic urinary bladder. Mice homozygous for a second null mutation display reduced chemical pain persistence responses but are otherwise healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Htr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Htr3a APN 9 48904627 missense probably damaging 0.99
R0238:Htr3a UTSW 9 48906386 missense probably benign 0.06
R0238:Htr3a UTSW 9 48906386 missense probably benign 0.06
R0403:Htr3a UTSW 9 48908659 missense probably damaging 0.96
R0899:Htr3a UTSW 9 48901452 missense possibly damaging 0.78
R1749:Htr3a UTSW 9 48900933 missense probably damaging 1.00
R1903:Htr3a UTSW 9 48906381 missense probably damaging 1.00
R1942:Htr3a UTSW 9 48908611 missense probably damaging 1.00
R2218:Htr3a UTSW 9 48908611 missense probably damaging 1.00
R2394:Htr3a UTSW 9 48906343 missense probably benign 0.29
R2402:Htr3a UTSW 9 48901495 missense probably damaging 1.00
R3430:Htr3a UTSW 9 48907388 missense probably benign 0.35
R6042:Htr3a UTSW 9 48904699 missense probably damaging 0.99
R6395:Htr3a UTSW 9 48900571 missense probably benign 0.00
R7791:Htr3a UTSW 9 48901575 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGTGAACTCTTCCCTCAGGG -3'
(R):5'- TTACTCTCAACTGCCACAGG -3'

Sequencing Primer
(F):5'- TCAGGGAAGCCTTACCAATG -3'
(R):5'- CCAGGCTGGAAGTTCTAT -3'
Posted On2018-05-04