Incidental Mutation 'R6407:Trim43c'
ID514500
Institutional Source Beutler Lab
Gene Symbol Trim43c
Ensembl Gene ENSMUSG00000067399
Gene Nametripartite motif-containing 43C
SynonymsTrim43
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location88839164-88848190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88840414 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 38 (T38S)
Ref Sequence ENSEMBL: ENSMUSP00000139715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163255] [ENSMUST00000186363]
Predicted Effect probably benign
Transcript: ENSMUST00000163255
AA Change: T38S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129255
Gene: ENSMUSG00000067399
AA Change: T38S

DomainStartEndE-ValueType
RING 16 56 3.34e-6 SMART
PDB:2IWG|E 329 446 3e-15 PDB
Blast:SPRY 336 441 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180783
Predicted Effect probably benign
Transcript: ENSMUST00000186363
AA Change: T38S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139715
Gene: ENSMUSG00000067399
AA Change: T38S

DomainStartEndE-ValueType
RING 16 56 1.6e-8 SMART
SPRY 334 445 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188156
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Trim43c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Trim43c APN 9 88841856 missense probably benign 0.20
IGL02414:Trim43c APN 9 88841832 critical splice acceptor site probably null
R0054:Trim43c UTSW 9 88847515 missense probably damaging 1.00
R0765:Trim43c UTSW 9 88841916 missense probably benign 0.28
R0862:Trim43c UTSW 9 88843034 missense probably benign 0.01
R0864:Trim43c UTSW 9 88843034 missense probably benign 0.01
R1117:Trim43c UTSW 9 88844977 missense probably benign 0.20
R1222:Trim43c UTSW 9 88843078 missense possibly damaging 0.70
R1643:Trim43c UTSW 9 88847477 missense probably damaging 0.97
R1691:Trim43c UTSW 9 88840699 missense probably damaging 0.98
R1914:Trim43c UTSW 9 88840617 missense probably benign 0.01
R3718:Trim43c UTSW 9 88844977 missense probably benign 0.20
R3772:Trim43c UTSW 9 88847757 missense probably damaging 1.00
R3852:Trim43c UTSW 9 88840401 missense probably damaging 1.00
R4774:Trim43c UTSW 9 88847652 missense possibly damaging 0.48
R5784:Trim43c UTSW 9 88847643 missense probably benign 0.03
R5833:Trim43c UTSW 9 88843037 missense possibly damaging 0.74
R6177:Trim43c UTSW 9 88840547 missense possibly damaging 0.50
R6490:Trim43c UTSW 9 88844950 missense possibly damaging 0.50
R6892:Trim43c UTSW 9 88844924 missense probably benign 0.35
Z1088:Trim43c UTSW 9 88842935 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTCAGACAATATGCCTTTCAGG -3'
(R):5'- TTTCGCCTTGTGGGTCACAC -3'

Sequencing Primer
(F):5'- CAGACAATATGCCTTTCAGGTTAAG -3'
(R):5'- ACACTTGTGCTCCTCAGAATTCAG -3'
Posted On2018-05-04