Incidental Mutation 'R6407:Pex3'
ID514501
Institutional Source Beutler Lab
Gene Symbol Pex3
Ensembl Gene ENSMUSG00000019809
Gene Nameperoxisomal biogenesis factor 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location13523842-13553142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13546368 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 63 (R63G)
Ref Sequence ENSEMBL: ENSMUSP00000128512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019945] [ENSMUST00000105539] [ENSMUST00000105541] [ENSMUST00000170376]
Predicted Effect probably damaging
Transcript: ENSMUST00000019945
AA Change: R63G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019945
Gene: ENSMUSG00000019809
AA Change: R63G

DomainStartEndE-ValueType
Pfam:Peroxin-3 4 99 9.9e-23 PFAM
Pfam:Peroxin-3 94 363 5.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105539
SMART Domains Protein: ENSMUSP00000101178
Gene: ENSMUSG00000019809

DomainStartEndE-ValueType
Pfam:Peroxin-3 28 298 6.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105541
SMART Domains Protein: ENSMUSP00000101180
Gene: ENSMUSG00000019809

DomainStartEndE-ValueType
Pfam:Peroxin-3 28 286 2e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145337
Predicted Effect probably damaging
Transcript: ENSMUST00000170376
AA Change: R63G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128512
Gene: ENSMUSG00000019809
AA Change: R63G

DomainStartEndE-ValueType
Pfam:Peroxin-3 2 97 2.4e-35 PFAM
Pfam:Peroxin-3 94 352 7.3e-75 PFAM
Meta Mutation Damage Score 0.8395 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is involved in peroxisome biosynthesis and integrity. It assembles membrane vesicles before the matrix proteins are translocated. Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. The peroxisomal biogenesis disorders are a heterogeneous group with at least 14 complementation groups and with more than 1 phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause Zellweger syndrome (ZWS). [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal sebaceous gland, hair follicle bulge, and cornea morphology. An increase in B and T cell numbers and mean platelet volume, and vertebral transformation are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Pex3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Pex3 APN 10 13552853 unclassified probably null
IGL02367:Pex3 APN 10 13524899 missense probably benign 0.39
IGL02538:Pex3 APN 10 13535600 missense possibly damaging 0.94
IGL02645:Pex3 APN 10 13546429 missense possibly damaging 0.92
IGL03096:Pex3 APN 10 13534663 splice site probably benign
R0076:Pex3 UTSW 10 13535594 missense probably benign 0.08
R0494:Pex3 UTSW 10 13527788 missense probably damaging 1.00
R0945:Pex3 UTSW 10 13542676 missense probably benign 0.43
R4574:Pex3 UTSW 10 13535571 nonsense probably null
R7549:Pex3 UTSW 10 13542670 missense probably benign
R7751:Pex3 UTSW 10 13527806 missense possibly damaging 0.67
R8033:Pex3 UTSW 10 13531280 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGACCTTACTCTGTTTACTGC -3'
(R):5'- AGCTGTAATTCTGAGGTTGACC -3'

Sequencing Primer
(F):5'- TCCCTCAAGGAGTGGCAG -3'
(R):5'- CTGAGGTTGACCCTAATATAAACCTC -3'
Posted On2018-05-04