Incidental Mutation 'R6407:Nhp2'
ID514505
Institutional Source Beutler Lab
Gene Symbol Nhp2
Ensembl Gene ENSMUSG00000001056
Gene NameNHP2 ribonucleoprotein
SynonymsH/ACA small nucleolar RNPs, NHP2, D11Ertd175e, 2410130M07Rik, Nola2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location51619735-51623714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51619903 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 29 (V29A)
Ref Sequence ENSEMBL: ENSMUSP00000120014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001081] [ENSMUST00000127405] [ENSMUST00000136020]
Predicted Effect probably benign
Transcript: ENSMUST00000001081
SMART Domains Protein: ENSMUSP00000001081
Gene: ENSMUSG00000001054

DomainStartEndE-ValueType
LisH 116 148 3.6e-4 SMART
CTLH 155 212 7.82e-14 SMART
CRA 210 304 1.63e-21 SMART
Pfam:zf-RING_UBOX 338 377 3.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000001083
Predicted Effect probably benign
Transcript: ENSMUST00000127405
AA Change: V29A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120014
Gene: ENSMUSG00000001056
AA Change: V29A

DomainStartEndE-ValueType
Pfam:Ribosomal_L7Ae 45 139 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136020
SMART Domains Protein: ENSMUSP00000120636
Gene: ENSMUSG00000001054

DomainStartEndE-ValueType
LisH 116 148 3.6e-4 SMART
CTLH 155 212 7.82e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147009
SMART Domains Protein: ENSMUSP00000118594
Gene: ENSMUSG00000001054

DomainStartEndE-ValueType
Pfam:CLTH 1 91 1.4e-11 PFAM
Pfam:zf-RING_UBOX 130 169 3.1e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA1 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. The four H/ACA snoRNP proteins are also components of the telomerase complex. This gene encodes a protein related to Saccharomyces cerevisiae Nhp2p. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Nhp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0324:Nhp2 UTSW 11 51622507 missense possibly damaging 0.74
R0723:Nhp2 UTSW 11 51619923 nonsense probably null
R6038:Nhp2 UTSW 11 51620085 missense probably benign 0.00
R6038:Nhp2 UTSW 11 51620085 missense probably benign 0.00
R6958:Nhp2 UTSW 11 51623107 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCCACTTGAAAACCCGG -3'
(R):5'- CGCCCTTGTTGACAAATTTCTG -3'

Sequencing Primer
(F):5'- CACTTGAAAACCCGGAAGTGATGTC -3'
(R):5'- GCGACGAATCTGCTTCTGC -3'
Posted On2018-05-04