Incidental Mutation 'R6407:Slc38a6'
ID514507
Institutional Source Beutler Lab
Gene Symbol Slc38a6
Ensembl Gene ENSMUSG00000044712
Gene Namesolute carrier family 38, member 6
SynonymsEG625098
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location73286779-73354049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73310175 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 115 (F115S)
Ref Sequence ENSEMBL: ENSMUSP00000114870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058139] [ENSMUST00000101313] [ENSMUST00000122920] [ENSMUST00000126488] [ENSMUST00000140523] [ENSMUST00000153941]
Predicted Effect probably benign
Transcript: ENSMUST00000058139
SMART Domains Protein: ENSMUSP00000057153
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 122 9.5e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101313
AA Change: F60S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098871
Gene: ENSMUSG00000044712
AA Change: F60S

DomainStartEndE-ValueType
Pfam:Aa_trans 1 69 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122920
SMART Domains Protein: ENSMUSP00000124386
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 113 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126488
SMART Domains Protein: ENSMUSP00000118374
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 122 9.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140523
AA Change: F115S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000120810
Gene: ENSMUSG00000044712
AA Change: F115S

DomainStartEndE-ValueType
Pfam:Aa_trans 44 452 2.5e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153941
AA Change: F115S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114870
Gene: ENSMUSG00000044712
AA Change: F115S

DomainStartEndE-ValueType
Pfam:Aa_trans 44 124 1.6e-15 PFAM
Meta Mutation Damage Score 0.1043 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Slc38a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Slc38a6 APN 12 73351803 missense probably benign 0.00
IGL01083:Slc38a6 APN 12 73288493 missense possibly damaging 0.94
IGL01302:Slc38a6 APN 12 73288525 critical splice donor site probably null
IGL02106:Slc38a6 APN 12 73350546 missense possibly damaging 0.84
IGL02429:Slc38a6 APN 12 73350568 missense probably benign 0.18
IGL02815:Slc38a6 APN 12 73292205 missense probably damaging 1.00
IGL03001:Slc38a6 APN 12 73337053 missense probably benign 0.03
IGL03167:Slc38a6 APN 12 73350537 nonsense probably null
R0394:Slc38a6 UTSW 12 73352530 missense probably benign
R0918:Slc38a6 UTSW 12 73344785 splice site probably null
R1377:Slc38a6 UTSW 12 73350571 missense probably damaging 0.98
R1533:Slc38a6 UTSW 12 73344852 missense probably benign 0.11
R4171:Slc38a6 UTSW 12 73350552 missense probably benign 0.21
R4579:Slc38a6 UTSW 12 73288524 critical splice donor site probably null
R4864:Slc38a6 UTSW 12 73343650 intron probably null
R5162:Slc38a6 UTSW 12 73329985 missense possibly damaging 0.70
R5627:Slc38a6 UTSW 12 73343683 missense possibly damaging 0.59
R6189:Slc38a6 UTSW 12 73310196 missense probably damaging 1.00
R6302:Slc38a6 UTSW 12 73337075 missense probably damaging 1.00
R7289:Slc38a6 UTSW 12 73287012 missense probably benign
R7462:Slc38a6 UTSW 12 73350577 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCTCAAAGGCCTTGCAAGAAG -3'
(R):5'- TCGGAAGGACCACAGATGTTTC -3'

Sequencing Primer
(F):5'- AGAAGCAGCTAGGCCTTCCTC -3'
(R):5'- GGACCACAGATGTTTCCATATTTTC -3'
Posted On2018-05-04