Incidental Mutation 'R6407:Ighg2c'
ID514508
Institutional Source Beutler Lab
Gene Symbol Ighg2c
Ensembl Gene ENSMUSG00000076612
Gene Nameimmunoglobulin heavy constant gamma 2C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location113287285-113288932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113288651 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 94 (K94E)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000103416
AA Change: K94E
SMART Domains Protein: ENSMUSP00000100212
Gene: ENSMUSG00000076612
AA Change: K94E

DomainStartEndE-ValueType
IGc1 21 91 2.4e-15 SMART
IG_like 143 218 1.64e-2 SMART
IGc1 249 322 1.97e-34 SMART
transmembrane domain 350 372 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000195192
AA Change: K94E
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Ighg2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02087:Ighg2c APN 12 113285366 unclassified probably benign
IGL02560:Ighg2c APN 12 113287884 missense unknown
IGL03339:Ighg2c APN 12 113287994 missense unknown
R0047:Ighg2c UTSW 12 113288168 splice site probably benign
R0047:Ighg2c UTSW 12 113288168 splice site probably benign
R0415:Ighg2c UTSW 12 113287910 missense unknown
R0571:Ighg2c UTSW 12 113288762 nonsense probably null
R0634:Ighg2c UTSW 12 113287964 missense unknown
R0893:Ighg2c UTSW 12 113287433 missense unknown
R1169:Ighg2c UTSW 12 113285952 unclassified probably benign
R3895:Ighg2c UTSW 12 113287658 missense unknown
R5065:Ighg2c UTSW 12 113288088 missense unknown
R6846:Ighg2c UTSW 12 113288310 missense unknown
R7052:Ighg2c UTSW 12 113288723 missense
R7231:Ighg2c UTSW 12 113288016 missense
R7513:Ighg2c UTSW 12 113288851 missense
Z1177:Ighg2c UTSW 12 113287680 missense not run
Predicted Primers PCR Primer
(F):5'- TCCTGGAAATGACAAGGACATC -3'
(R):5'- GTGACCTTGACCTGGAACTCTG -3'

Sequencing Primer
(F):5'- TCCTAGAGGATCATGACCTTGAG -3'
(R):5'- TGACCTGGAACTCTGGATCC -3'
Posted On2018-05-04