Incidental Mutation 'R6407:Mrpl39'
ID514511
Institutional Source Beutler Lab
Gene Symbol Mrpl39
Ensembl Gene ENSMUSG00000022889
Gene Namemitochondrial ribosomal protein L39
SynonymsMRP-L5, Rpml5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location84717576-84735742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84732385 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 123 (K123R)
Ref Sequence ENSEMBL: ENSMUSP00000112283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116584]
Predicted Effect probably benign
Transcript: ENSMUST00000116584
AA Change: K123R

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000112283
Gene: ENSMUSG00000022889
AA Change: K123R

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
SCOP:d1a04a1 27 69 8e-3 SMART
PDB:4CE4|C 66 335 N/A PDB
SCOP:d1qf6a2 73 126 1e-2 SMART
SCOP:d1qf6a3 128 319 4e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157433
Meta Mutation Damage Score 0.1059 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Two transcript variants encoding distinct isoforms have been described. A pseudogene corresponding to this gene is found on chromosome 5q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Mrpl39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Mrpl39 APN 16 84723852 missense probably damaging 1.00
R0671:Mrpl39 UTSW 16 84734394 splice site probably benign
R1682:Mrpl39 UTSW 16 84730459 missense probably damaging 0.99
R2357:Mrpl39 UTSW 16 84727564 missense probably benign 0.00
R2424:Mrpl39 UTSW 16 84730860 missense probably benign
R4418:Mrpl39 UTSW 16 84725124 critical splice donor site probably null
R4976:Mrpl39 UTSW 16 84734405 critical splice donor site probably null
R5375:Mrpl39 UTSW 16 84723902 missense probably damaging 1.00
R5730:Mrpl39 UTSW 16 84732434 missense probably damaging 1.00
R5948:Mrpl39 UTSW 16 84725153 missense probably benign 0.25
R6910:Mrpl39 UTSW 16 84735192 missense unknown
Z1176:Mrpl39 UTSW 16 84723972 missense not run
Predicted Primers PCR Primer
(F):5'- GGTACCACCAGTATTTTGAACTAC -3'
(R):5'- GCAAAAGTAATCCCCAGAATTTTGC -3'

Sequencing Primer
(F):5'- CTCCATTGCACATAGGTTG -3'
(R):5'- ATCCCCAGAATTTTGCTTCAATTG -3'
Posted On2018-05-04