Incidental Mutation 'R6408:Tbc1d8'
ID514515
Institutional Source Beutler Lab
Gene Symbol Tbc1d8
Ensembl Gene ENSMUSG00000003134
Gene NameTBC1 domain family, member 8
SynonymsGRAM domain, AD3, HBLP1, BUB2-like protein 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6408 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location39371492-39478755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39402899 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 204 (D204V)
Ref Sequence ENSEMBL: ENSMUSP00000141750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054462] [ENSMUST00000192531] [ENSMUST00000193823]
Predicted Effect probably damaging
Transcript: ENSMUST00000054462
AA Change: D204V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049967
Gene: ENSMUSG00000003134
AA Change: D204V

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 3.6e-20 SMART
GRAM 285 353 2.77e-21 SMART
TBC 501 714 4.51e-54 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 991 N/A INTRINSIC
low complexity region 1030 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192531
SMART Domains Protein: ENSMUSP00000142143
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 80 98 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193823
AA Change: D204V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141750
Gene: ENSMUSG00000003134
AA Change: D204V

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 1.2e-22 SMART
GRAM 285 353 9.6e-24 SMART
TBC 501 714 2.2e-56 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Tbc1d8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tbc1d8 APN 1 39394129 missense probably damaging 0.96
IGL01501:Tbc1d8 APN 1 39389335 missense probably damaging 1.00
IGL01548:Tbc1d8 APN 1 39381304 missense probably damaging 0.96
IGL01884:Tbc1d8 APN 1 39376445 missense probably damaging 1.00
IGL01919:Tbc1d8 APN 1 39392253 missense probably damaging 1.00
IGL02123:Tbc1d8 APN 1 39376907 missense possibly damaging 0.54
IGL02123:Tbc1d8 APN 1 39380236 missense probably damaging 0.98
IGL02135:Tbc1d8 APN 1 39402810 missense probably damaging 1.00
IGL02317:Tbc1d8 APN 1 39376904 missense probably benign 0.00
IGL02325:Tbc1d8 APN 1 39394240 missense probably damaging 0.99
IGL02607:Tbc1d8 APN 1 39379511 missense probably benign 0.05
R0533:Tbc1d8 UTSW 1 39372774 missense possibly damaging 0.82
R0604:Tbc1d8 UTSW 1 39405326 missense probably damaging 1.00
R0612:Tbc1d8 UTSW 1 39372515 missense possibly damaging 0.92
R0639:Tbc1d8 UTSW 1 39391209 missense probably benign 0.00
R0976:Tbc1d8 UTSW 1 39406801 missense probably damaging 1.00
R1051:Tbc1d8 UTSW 1 39381453 nonsense probably null
R1605:Tbc1d8 UTSW 1 39391125 missense probably benign 0.38
R1622:Tbc1d8 UTSW 1 39380236 missense probably benign 0.00
R1710:Tbc1d8 UTSW 1 39406837 missense possibly damaging 0.89
R2419:Tbc1d8 UTSW 1 39376902 missense probably damaging 1.00
R2437:Tbc1d8 UTSW 1 39405287 splice site probably null
R2862:Tbc1d8 UTSW 1 39402696 nonsense probably null
R2870:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2870:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2872:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2872:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2873:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2874:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R3759:Tbc1d8 UTSW 1 39376465 missense probably damaging 1.00
R4127:Tbc1d8 UTSW 1 39372431 missense probably benign 0.05
R4154:Tbc1d8 UTSW 1 39386135 missense probably damaging 0.99
R4613:Tbc1d8 UTSW 1 39372708 missense probably damaging 0.98
R4737:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4738:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4739:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4740:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R5189:Tbc1d8 UTSW 1 39385132 missense probably benign 0.00
R5271:Tbc1d8 UTSW 1 39373767 missense probably damaging 0.97
R5308:Tbc1d8 UTSW 1 39389409 missense probably damaging 1.00
R5393:Tbc1d8 UTSW 1 39426088 missense probably damaging 0.99
R5529:Tbc1d8 UTSW 1 39372755 missense probably benign 0.42
R5897:Tbc1d8 UTSW 1 39392109 missense possibly damaging 0.95
R6160:Tbc1d8 UTSW 1 39372403 missense probably damaging 0.98
R6409:Tbc1d8 UTSW 1 39372588 missense probably benign 0.00
R6554:Tbc1d8 UTSW 1 39406822 missense probably damaging 1.00
R6841:Tbc1d8 UTSW 1 39389374 missense possibly damaging 0.68
R7282:Tbc1d8 UTSW 1 39372533 missense probably benign 0.00
R7294:Tbc1d8 UTSW 1 39406762 missense probably damaging 1.00
R7384:Tbc1d8 UTSW 1 39394098 missense probably benign 0.00
R7718:Tbc1d8 UTSW 1 39376980 missense probably benign 0.00
R7881:Tbc1d8 UTSW 1 39386023 missense probably damaging 0.98
R7964:Tbc1d8 UTSW 1 39386023 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAACCTCGTTGTCCAGCAG -3'
(R):5'- TGGGAAGCTTCACCCAAATCG -3'

Sequencing Primer
(F):5'- TTGTCCAGCAGCCTCCG -3'
(R):5'- CCAAATCGGTGTGAAGCCACTG -3'
Posted On2018-05-04