Incidental Mutation 'R6408:Cubn'
ID 514519
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Name cubilin
Synonyms D2Wsu88e, intrinsic factor-cobalamin receptor
MMRRC Submission 044553-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6408 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 13281149-13496624 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 13299014 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 3220 (V3220M)
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000091436
AA Change: V3220M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: V3220M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149137
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,691,858 (GRCm39) S50P probably damaging Het
4930407I10Rik T C 15: 81,949,307 (GRCm39) V1068A possibly damaging Het
Acss1 A G 2: 150,470,412 (GRCm39) probably null Het
Amer2 T C 14: 60,617,674 (GRCm39) I497T probably damaging Het
Azi2 A T 9: 117,890,550 (GRCm39) R51* probably null Het
Brdt A G 5: 107,533,358 (GRCm39) D946G probably damaging Het
Bzw2 C T 12: 36,157,524 (GRCm39) V314I possibly damaging Het
Capn13 A T 17: 73,672,954 (GRCm39) Y116* probably null Het
Clca4b A G 3: 144,625,036 (GRCm39) I485T probably benign Het
Crybg3 T A 16: 59,316,053 (GRCm39) T1130S possibly damaging Het
Cyp4f16 T A 17: 32,770,173 (GRCm39) L514Q probably damaging Het
D7Ertd443e G T 7: 133,951,440 (GRCm39) Q31K probably benign Het
Dcaf15 T C 8: 84,831,355 (GRCm39) E8G probably benign Het
Ddx24 A C 12: 103,391,819 (GRCm39) probably benign Het
Diaph3 T C 14: 87,066,430 (GRCm39) M988V possibly damaging Het
Dlx4 A G 11: 95,036,078 (GRCm39) V77A probably benign Het
Dnah3 T C 7: 119,522,191 (GRCm39) probably null Het
Drc1 A G 5: 30,513,632 (GRCm39) E396G probably benign Het
Gab1 C A 8: 81,515,226 (GRCm39) R364L possibly damaging Het
Gbp2b T C 3: 142,323,899 (GRCm39) L568S probably benign Het
Gjb5 A T 4: 127,249,940 (GRCm39) F68Y probably benign Het
Hs6st3 C A 14: 119,376,046 (GRCm39) P74T probably benign Het
Kif26b T C 1: 178,745,133 (GRCm39) L1743P probably damaging Het
Lnx1 A T 5: 74,846,307 (GRCm39) C48S probably damaging Het
Lrfn2 A G 17: 49,377,654 (GRCm39) H245R probably damaging Het
Lrrc27 A G 7: 138,798,184 (GRCm39) E93G probably benign Het
Mettl6 T C 14: 31,201,683 (GRCm39) E253G probably damaging Het
Nmu A T 5: 76,491,818 (GRCm39) F106Y probably damaging Het
Pcsk7 T C 9: 45,820,994 (GRCm39) I142T probably benign Het
Polr3a A T 14: 24,536,939 (GRCm39) probably null Het
Psmb9 G T 17: 34,404,707 (GRCm39) A19E probably damaging Het
Pus7l A G 15: 94,429,456 (GRCm39) M454T probably benign Het
Raet1e A G 10: 22,056,645 (GRCm39) T74A probably benign Het
Ralb A C 1: 119,405,839 (GRCm39) Y43* probably null Het
Ralgapa1 C A 12: 55,730,695 (GRCm39) E1947* probably null Het
Rnf26rt A G 6: 76,473,441 (GRCm39) C392R probably damaging Het
Robo1 T C 16: 72,768,934 (GRCm39) Y500H probably benign Het
Shroom1 A C 11: 53,354,214 (GRCm39) T45P probably benign Het
Slit2 A G 5: 48,142,328 (GRCm39) probably benign Het
Spmip2 A G 3: 79,356,706 (GRCm39) R170G probably benign Het
Srgap3 T C 6: 112,699,967 (GRCm39) S1004G probably damaging Het
Taok2 A G 7: 126,470,164 (GRCm39) V888A probably benign Het
Tbc1d8 T A 1: 39,441,980 (GRCm39) D204V probably damaging Het
Thoc2l A G 5: 104,666,643 (GRCm39) I388M probably benign Het
Trav7d-4 C A 14: 53,007,624 (GRCm39) A39D probably damaging Het
Ush2a G T 1: 187,999,229 (GRCm39) E180* probably null Het
Vmn1r37 A G 6: 66,708,563 (GRCm39) D63G probably benign Het
Zfp282 G A 6: 47,857,319 (GRCm39) R184Q probably damaging Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13,496,631 (GRCm39) unclassified probably benign
IGL00228:Cubn APN 2 13,461,508 (GRCm39) missense probably damaging 1.00
IGL00231:Cubn APN 2 13,386,660 (GRCm39) missense possibly damaging 0.89
IGL00327:Cubn APN 2 13,431,867 (GRCm39) missense possibly damaging 0.73
IGL00470:Cubn APN 2 13,283,229 (GRCm39) missense probably benign 0.00
IGL00519:Cubn APN 2 13,287,730 (GRCm39) missense probably benign 0.00
IGL00562:Cubn APN 2 13,299,041 (GRCm39) missense probably benign 0.01
IGL00678:Cubn APN 2 13,472,521 (GRCm39) missense possibly damaging 0.47
IGL00834:Cubn APN 2 13,386,738 (GRCm39) missense probably damaging 1.00
IGL00946:Cubn APN 2 13,461,434 (GRCm39) missense probably damaging 0.98
IGL00971:Cubn APN 2 13,283,219 (GRCm39) missense possibly damaging 0.77
IGL01124:Cubn APN 2 13,482,904 (GRCm39) missense possibly damaging 0.62
IGL01287:Cubn APN 2 13,315,377 (GRCm39) missense probably damaging 1.00
IGL01410:Cubn APN 2 13,470,719 (GRCm39) missense probably benign 0.31
IGL01418:Cubn APN 2 13,288,852 (GRCm39) missense probably benign 0.01
IGL01450:Cubn APN 2 13,355,673 (GRCm39) splice site probably benign
IGL01534:Cubn APN 2 13,470,744 (GRCm39) nonsense probably null
IGL01584:Cubn APN 2 13,313,472 (GRCm39) splice site probably benign
IGL01595:Cubn APN 2 13,330,027 (GRCm39) missense probably benign 0.05
IGL01625:Cubn APN 2 13,311,085 (GRCm39) missense possibly damaging 0.76
IGL01732:Cubn APN 2 13,494,747 (GRCm39) nonsense probably null
IGL01972:Cubn APN 2 13,450,883 (GRCm39) missense possibly damaging 0.90
IGL02027:Cubn APN 2 13,292,405 (GRCm39) missense probably damaging 1.00
IGL02033:Cubn APN 2 13,344,657 (GRCm39) missense probably damaging 0.98
IGL02124:Cubn APN 2 13,386,648 (GRCm39) missense probably damaging 0.99
IGL02335:Cubn APN 2 13,432,645 (GRCm39) splice site probably null
IGL02491:Cubn APN 2 13,326,039 (GRCm39) missense probably damaging 1.00
IGL02686:Cubn APN 2 13,330,037 (GRCm39) missense possibly damaging 0.92
IGL02707:Cubn APN 2 13,450,843 (GRCm39) missense probably damaging 0.99
IGL02746:Cubn APN 2 13,449,851 (GRCm39) missense probably damaging 1.00
IGL02873:Cubn APN 2 13,299,181 (GRCm39) missense probably benign 0.07
IGL02897:Cubn APN 2 13,323,123 (GRCm39) missense possibly damaging 0.55
IGL03078:Cubn APN 2 13,291,905 (GRCm39) missense possibly damaging 0.87
IGL03245:Cubn APN 2 13,360,500 (GRCm39) missense probably benign 0.09
IGL03289:Cubn APN 2 13,431,778 (GRCm39) missense probably benign 0.00
IGL03335:Cubn APN 2 13,365,140 (GRCm39) missense probably damaging 1.00
IGL03355:Cubn APN 2 13,482,868 (GRCm39) splice site probably null
mellow UTSW 2 13,482,889 (GRCm39) missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13,473,663 (GRCm39) nonsense probably null
PIT4495001:Cubn UTSW 2 13,496,561 (GRCm39) missense probably benign 0.00
R0145:Cubn UTSW 2 13,311,243 (GRCm39) missense probably damaging 1.00
R0220:Cubn UTSW 2 13,361,520 (GRCm39) missense probably damaging 1.00
R0254:Cubn UTSW 2 13,480,846 (GRCm39) critical splice donor site probably null
R0254:Cubn UTSW 2 13,445,325 (GRCm39) missense possibly damaging 0.84
R0254:Cubn UTSW 2 13,429,505 (GRCm39) missense probably benign 0.01
R0360:Cubn UTSW 2 13,315,318 (GRCm39) splice site probably benign
R0364:Cubn UTSW 2 13,315,318 (GRCm39) splice site probably benign
R0383:Cubn UTSW 2 13,435,770 (GRCm39) missense probably damaging 1.00
R0419:Cubn UTSW 2 13,474,575 (GRCm39) missense possibly damaging 0.87
R0419:Cubn UTSW 2 13,474,574 (GRCm39) missense possibly damaging 0.77
R0498:Cubn UTSW 2 13,449,078 (GRCm39) missense probably damaging 0.99
R0560:Cubn UTSW 2 13,433,491 (GRCm39) missense probably damaging 1.00
R0615:Cubn UTSW 2 13,365,063 (GRCm39) splice site probably null
R0735:Cubn UTSW 2 13,496,500 (GRCm39) splice site probably benign
R0780:Cubn UTSW 2 13,461,424 (GRCm39) missense probably damaging 1.00
R0899:Cubn UTSW 2 13,367,139 (GRCm39) missense possibly damaging 0.54
R1118:Cubn UTSW 2 13,341,053 (GRCm39) missense possibly damaging 0.78
R1182:Cubn UTSW 2 13,449,811 (GRCm39) missense probably damaging 0.98
R1439:Cubn UTSW 2 13,292,379 (GRCm39) missense probably damaging 0.96
R1450:Cubn UTSW 2 13,365,130 (GRCm39) missense probably damaging 1.00
R1464:Cubn UTSW 2 13,330,099 (GRCm39) missense possibly damaging 0.87
R1464:Cubn UTSW 2 13,330,099 (GRCm39) missense possibly damaging 0.87
R1476:Cubn UTSW 2 13,480,931 (GRCm39) missense probably benign 0.04
R1508:Cubn UTSW 2 13,431,916 (GRCm39) missense probably benign 0.25
R1532:Cubn UTSW 2 13,292,472 (GRCm39) missense probably damaging 1.00
R1562:Cubn UTSW 2 13,432,778 (GRCm39) missense probably damaging 1.00
R1598:Cubn UTSW 2 13,474,600 (GRCm39) missense probably benign 0.00
R1761:Cubn UTSW 2 13,494,128 (GRCm39) critical splice donor site probably null
R1862:Cubn UTSW 2 13,313,372 (GRCm39) missense probably damaging 1.00
R1874:Cubn UTSW 2 13,327,813 (GRCm39) missense probably damaging 1.00
R1923:Cubn UTSW 2 13,315,337 (GRCm39) missense probably damaging 1.00
R1944:Cubn UTSW 2 13,283,349 (GRCm39) missense probably benign 0.01
R1960:Cubn UTSW 2 13,344,828 (GRCm39) splice site probably null
R2021:Cubn UTSW 2 13,313,360 (GRCm39) missense probably benign 0.09
R2137:Cubn UTSW 2 13,340,978 (GRCm39) missense probably benign 0.01
R2138:Cubn UTSW 2 13,449,189 (GRCm39) missense probably damaging 0.99
R2139:Cubn UTSW 2 13,340,978 (GRCm39) missense probably benign 0.01
R2179:Cubn UTSW 2 13,323,053 (GRCm39) missense possibly damaging 0.85
R2328:Cubn UTSW 2 13,408,891 (GRCm39) nonsense probably null
R2369:Cubn UTSW 2 13,496,028 (GRCm39) missense probably damaging 1.00
R2428:Cubn UTSW 2 13,480,961 (GRCm39) missense probably damaging 1.00
R2435:Cubn UTSW 2 13,323,083 (GRCm39) missense probably damaging 1.00
R2567:Cubn UTSW 2 13,283,167 (GRCm39) splice site probably null
R2850:Cubn UTSW 2 13,327,764 (GRCm39) missense probably damaging 1.00
R2853:Cubn UTSW 2 13,435,645 (GRCm39) missense probably benign 0.00
R2893:Cubn UTSW 2 13,362,950 (GRCm39) missense possibly damaging 0.61
R3107:Cubn UTSW 2 13,367,158 (GRCm39) missense possibly damaging 0.73
R3109:Cubn UTSW 2 13,367,158 (GRCm39) missense possibly damaging 0.73
R3119:Cubn UTSW 2 13,362,973 (GRCm39) missense possibly damaging 0.90
R3405:Cubn UTSW 2 13,338,319 (GRCm39) missense probably benign 0.00
R3703:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3704:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3705:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3764:Cubn UTSW 2 13,336,396 (GRCm39) missense possibly damaging 0.79
R3792:Cubn UTSW 2 13,432,725 (GRCm39) missense probably damaging 1.00
R3802:Cubn UTSW 2 13,365,164 (GRCm39) missense probably benign 0.01
R3813:Cubn UTSW 2 13,299,136 (GRCm39) missense probably damaging 1.00
R3845:Cubn UTSW 2 13,287,819 (GRCm39) missense probably damaging 1.00
R3846:Cubn UTSW 2 13,287,819 (GRCm39) missense probably damaging 1.00
R3900:Cubn UTSW 2 13,291,791 (GRCm39) critical splice donor site probably null
R3921:Cubn UTSW 2 13,331,488 (GRCm39) missense probably damaging 1.00
R4075:Cubn UTSW 2 13,318,810 (GRCm39) missense possibly damaging 0.58
R4082:Cubn UTSW 2 13,433,374 (GRCm39) intron probably benign
R4405:Cubn UTSW 2 13,470,841 (GRCm39) missense probably damaging 1.00
R4615:Cubn UTSW 2 13,433,560 (GRCm39) missense probably damaging 1.00
R4629:Cubn UTSW 2 13,318,790 (GRCm39) splice site probably null
R4770:Cubn UTSW 2 13,319,578 (GRCm39) missense possibly damaging 0.92
R4799:Cubn UTSW 2 13,355,869 (GRCm39) missense probably damaging 1.00
R4799:Cubn UTSW 2 13,291,835 (GRCm39) missense possibly damaging 0.94
R4812:Cubn UTSW 2 13,463,887 (GRCm39) missense probably damaging 1.00
R4825:Cubn UTSW 2 13,330,036 (GRCm39) missense probably damaging 1.00
R4934:Cubn UTSW 2 13,494,721 (GRCm39) missense probably benign 0.06
R4967:Cubn UTSW 2 13,352,856 (GRCm39) missense probably benign 0.01
R5187:Cubn UTSW 2 13,292,379 (GRCm39) missense probably damaging 0.96
R5232:Cubn UTSW 2 13,483,013 (GRCm39) nonsense probably null
R5305:Cubn UTSW 2 13,393,750 (GRCm39) missense probably damaging 1.00
R5506:Cubn UTSW 2 13,496,506 (GRCm39) splice site probably null
R5530:Cubn UTSW 2 13,313,334 (GRCm39) missense probably damaging 1.00
R5531:Cubn UTSW 2 13,355,743 (GRCm39) missense probably benign 0.00
R5737:Cubn UTSW 2 13,393,702 (GRCm39) missense probably damaging 1.00
R5886:Cubn UTSW 2 13,324,834 (GRCm39) splice site probably benign
R5923:Cubn UTSW 2 13,490,889 (GRCm39) missense possibly damaging 0.73
R6032:Cubn UTSW 2 13,329,995 (GRCm39) missense probably benign 0.12
R6032:Cubn UTSW 2 13,329,995 (GRCm39) missense probably benign 0.12
R6084:Cubn UTSW 2 13,435,708 (GRCm39) missense probably damaging 1.00
R6087:Cubn UTSW 2 13,432,658 (GRCm39) missense probably damaging 1.00
R6133:Cubn UTSW 2 13,313,429 (GRCm39) missense probably benign 0.29
R6181:Cubn UTSW 2 13,354,687 (GRCm39) missense probably benign 0.31
R6301:Cubn UTSW 2 13,482,889 (GRCm39) missense probably damaging 1.00
R6320:Cubn UTSW 2 13,285,006 (GRCm39) missense probably damaging 1.00
R6368:Cubn UTSW 2 13,480,934 (GRCm39) missense probably damaging 0.98
R6368:Cubn UTSW 2 13,435,806 (GRCm39) missense probably damaging 0.96
R6383:Cubn UTSW 2 13,432,646 (GRCm39) critical splice donor site probably null
R6393:Cubn UTSW 2 13,360,491 (GRCm39) missense probably benign 0.08
R6470:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R6532:Cubn UTSW 2 13,463,813 (GRCm39) missense probably benign 0.01
R6599:Cubn UTSW 2 13,315,484 (GRCm39) missense possibly damaging 0.95
R6629:Cubn UTSW 2 13,435,683 (GRCm39) missense probably damaging 1.00
R6641:Cubn UTSW 2 13,480,875 (GRCm39) missense probably damaging 1.00
R6800:Cubn UTSW 2 13,326,066 (GRCm39) missense probably damaging 1.00
R6823:Cubn UTSW 2 13,449,840 (GRCm39) missense probably benign 0.21
R6847:Cubn UTSW 2 13,449,064 (GRCm39) critical splice donor site probably null
R6885:Cubn UTSW 2 13,323,089 (GRCm39) missense probably damaging 1.00
R6962:Cubn UTSW 2 13,352,840 (GRCm39) missense probably benign 0.03
R6973:Cubn UTSW 2 13,386,648 (GRCm39) missense possibly damaging 0.61
R6975:Cubn UTSW 2 13,491,600 (GRCm39) missense probably damaging 0.99
R7076:Cubn UTSW 2 13,311,092 (GRCm39) missense probably benign 0.10
R7076:Cubn UTSW 2 13,311,091 (GRCm39) missense probably benign 0.00
R7086:Cubn UTSW 2 13,324,669 (GRCm39) missense probably damaging 0.98
R7162:Cubn UTSW 2 13,347,309 (GRCm39) missense probably damaging 0.96
R7203:Cubn UTSW 2 13,355,814 (GRCm39) missense probably benign 0.01
R7292:Cubn UTSW 2 13,429,550 (GRCm39) missense probably damaging 0.99
R7307:Cubn UTSW 2 13,345,143 (GRCm39) missense probably damaging 0.99
R7329:Cubn UTSW 2 13,473,582 (GRCm39) missense probably damaging 0.99
R7395:Cubn UTSW 2 13,291,875 (GRCm39) missense probably damaging 1.00
R7417:Cubn UTSW 2 13,431,778 (GRCm39) missense probably benign 0.00
R7429:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R7430:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R7443:Cubn UTSW 2 13,460,320 (GRCm39) missense probably damaging 1.00
R7699:Cubn UTSW 2 13,494,728 (GRCm39) missense possibly damaging 0.74
R7699:Cubn UTSW 2 13,352,989 (GRCm39) missense probably benign
R7700:Cubn UTSW 2 13,494,728 (GRCm39) missense possibly damaging 0.74
R7700:Cubn UTSW 2 13,352,989 (GRCm39) missense probably benign
R7751:Cubn UTSW 2 13,365,176 (GRCm39) missense probably damaging 1.00
R7755:Cubn UTSW 2 13,284,889 (GRCm39) missense probably benign 0.11
R7759:Cubn UTSW 2 13,352,961 (GRCm39) missense probably damaging 1.00
R7903:Cubn UTSW 2 13,473,680 (GRCm39) missense probably damaging 0.97
R7921:Cubn UTSW 2 13,429,538 (GRCm39) missense probably benign 0.22
R7988:Cubn UTSW 2 13,337,166 (GRCm39) missense probably benign 0.43
R8010:Cubn UTSW 2 13,340,897 (GRCm39) critical splice donor site probably null
R8020:Cubn UTSW 2 13,483,989 (GRCm39) missense probably benign 0.01
R8120:Cubn UTSW 2 13,336,471 (GRCm39) missense probably damaging 1.00
R8133:Cubn UTSW 2 13,393,659 (GRCm39) missense probably damaging 1.00
R8185:Cubn UTSW 2 13,299,129 (GRCm39) missense probably benign 0.11
R8224:Cubn UTSW 2 13,354,688 (GRCm39) missense probably benign 0.16
R8289:Cubn UTSW 2 13,491,613 (GRCm39) missense probably benign 0.10
R8326:Cubn UTSW 2 13,311,274 (GRCm39) missense probably benign 0.01
R8331:Cubn UTSW 2 13,345,053 (GRCm39) missense probably damaging 1.00
R8338:Cubn UTSW 2 13,435,658 (GRCm39) missense probably benign 0.08
R8341:Cubn UTSW 2 13,433,535 (GRCm39) missense probably damaging 1.00
R8358:Cubn UTSW 2 13,329,971 (GRCm39) missense probably benign 0.17
R8427:Cubn UTSW 2 13,433,567 (GRCm39) missense probably benign 0.00
R8432:Cubn UTSW 2 13,386,610 (GRCm39) missense probably benign 0.00
R8441:Cubn UTSW 2 13,432,658 (GRCm39) missense probably damaging 1.00
R8442:Cubn UTSW 2 13,318,855 (GRCm39) missense probably damaging 1.00
R8520:Cubn UTSW 2 13,313,331 (GRCm39) critical splice donor site probably null
R8699:Cubn UTSW 2 13,388,770 (GRCm39) missense probably damaging 1.00
R8753:Cubn UTSW 2 13,313,377 (GRCm39) nonsense probably null
R8874:Cubn UTSW 2 13,365,157 (GRCm39) missense possibly damaging 0.63
R9056:Cubn UTSW 2 13,461,466 (GRCm39) missense probably damaging 1.00
R9079:Cubn UTSW 2 13,291,914 (GRCm39) missense probably benign 0.02
R9143:Cubn UTSW 2 13,337,276 (GRCm39) splice site probably benign
R9261:Cubn UTSW 2 13,283,262 (GRCm39) missense probably damaging 1.00
R9338:Cubn UTSW 2 13,386,703 (GRCm39) missense probably damaging 1.00
R9342:Cubn UTSW 2 13,463,767 (GRCm39) missense probably damaging 0.99
R9603:Cubn UTSW 2 13,292,510 (GRCm39) missense probably damaging 1.00
R9614:Cubn UTSW 2 13,482,945 (GRCm39) missense probably benign 0.00
R9615:Cubn UTSW 2 13,325,991 (GRCm39) missense possibly damaging 0.88
R9616:Cubn UTSW 2 13,319,529 (GRCm39) missense probably benign 0.04
R9774:Cubn UTSW 2 13,433,530 (GRCm39) missense probably benign
X0018:Cubn UTSW 2 13,463,797 (GRCm39) missense probably damaging 1.00
X0022:Cubn UTSW 2 13,480,887 (GRCm39) missense probably damaging 1.00
X0026:Cubn UTSW 2 13,347,392 (GRCm39) missense probably damaging 1.00
X0063:Cubn UTSW 2 13,327,773 (GRCm39) missense probably damaging 1.00
YA93:Cubn UTSW 2 13,388,803 (GRCm39) missense probably benign 0.21
Z1088:Cubn UTSW 2 13,299,040 (GRCm39) missense probably benign 0.43
Z1176:Cubn UTSW 2 13,386,636 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACTTAGCAAGACAGAACTG -3'
(R):5'- ACCTGACTGAGGACAGCAAG -3'

Sequencing Primer
(F):5'- CTTAGCAAGACAGAACTGAATCTTG -3'
(R):5'- CAAGAGCTTTGTGTCTCCTGATCATG -3'
Posted On 2018-05-04