Incidental Mutation 'R6408:Acss1'
ID514520
Institutional Source Beutler Lab
Gene Symbol Acss1
Ensembl Gene ENSMUSG00000027452
Gene Nameacyl-CoA synthetase short-chain family member 1
SynonymsAcas2l, Acas2, 1110032O15Rik, AceCS2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6408 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location150618105-150668500 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 150628492 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028944]
Predicted Effect probably null
Transcript: ENSMUST00000028944
SMART Domains Protein: ENSMUSP00000028944
Gene: ENSMUSG00000027452

DomainStartEndE-ValueType
low complexity region 4 29 N/A INTRINSIC
Pfam:ACAS_N 51 107 8.6e-17 PFAM
Pfam:AMP-binding 108 549 2.5e-90 PFAM
Pfam:AMP-binding_C 557 635 7.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154328
Meta Mutation Damage Score 0.476 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial acetyl-CoA synthetase enzyme. A similar protein in mice plays an important role in the tricarboxylic acid cycle by catalyzing the conversion of acetate to acetyl CoA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice with disruptions in this gene display abnormalities in acetate metabolism. Ability to maintain body temperature under fasting conditions is reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Acss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Acss1 APN 2 150619686 missense probably benign 0.27
IGL01594:Acss1 APN 2 150621530 missense probably damaging 0.98
IGL01781:Acss1 APN 2 150637872 missense probably damaging 1.00
IGL02189:Acss1 APN 2 150629868 missense probably damaging 0.98
IGL02735:Acss1 APN 2 150638467 missense probably damaging 1.00
IGL02738:Acss1 APN 2 150624872 splice site probably benign
IGL03399:Acss1 APN 2 150637878 missense probably damaging 1.00
Cutlass UTSW 2 150668131 nonsense probably null
scimitar UTSW 2 150628492 critical splice donor site probably null
R0058:Acss1 UTSW 2 150628539 missense probably damaging 0.97
R0063:Acss1 UTSW 2 150627292 missense probably damaging 1.00
R0063:Acss1 UTSW 2 150627292 missense probably damaging 1.00
R1550:Acss1 UTSW 2 150642795 missense probably damaging 0.99
R1651:Acss1 UTSW 2 150638437 missense possibly damaging 0.94
R2066:Acss1 UTSW 2 150668131 nonsense probably null
R4414:Acss1 UTSW 2 150659903 missense possibly damaging 0.58
R4559:Acss1 UTSW 2 150638485 missense probably benign 0.19
R4893:Acss1 UTSW 2 150629866 missense probably damaging 0.97
R6459:Acss1 UTSW 2 150667920 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCATTCCATGGCCTGACTTC -3'
(R):5'- AAAATAGGTCATGCTTGGTGGAC -3'

Sequencing Primer
(F):5'- TGTCTGTCAGGAAAGCTCCCAAG -3'
(R):5'- ACTACCTGGCTGACTGTGAC -3'
Posted On2018-05-04