Mutagenetix > Incidental Mutations

Incidental Mutation 'R6408:Brdt'

514530

Institutional Source

Beutler Lab

Gene Symbol

Brdt

Ensembl Gene

ENSMUSG00000029279

Gene Name

bromodomain, testis-specific

Synonyms

Fsrg3, 7420412D09Rik, Brd6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6408 (G1)

Quality Score

216.009

Status

Validated

Chromosome

Chromosomal Location

107331159-107387058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107385492 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 946 (D946G)

Ref Sequence

ENSEMBL: ENSMUSP00000031215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031215]

AlphaFold

Q91Y44

PDB Structure

Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031215
AA Change: D946G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: D946G

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
BROMO	268	377	2.18e-40	SMART
low complexity region	392	417	N/A	INTRINSIC
low complexity region	446	455	N/A	INTRINSIC
low complexity region	472	500	N/A	INTRINSIC
Pfam:BET	505	569	9.2e-34	PFAM
low complexity region	585	603	N/A	INTRINSIC
low complexity region	649	691	N/A	INTRINSIC
low complexity region	895	909	N/A	INTRINSIC
Pfam:BRD4_CDT	913	956	3e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162804

Meta Mutation Damage Score

0.1582

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.2%

Validation Efficiency

94% (45/48)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	T	C	5: 107,543,992	S50P	probably damaging	Het
4930407I10Rik	T	C	15: 82,065,106	V1068A	possibly damaging	Het
Acss1	A	G	2: 150,628,492		probably null	Het
Amer2	T	C	14: 60,380,225	I497T	probably damaging	Het
Azi2	A	T	9: 118,061,482	R51*	probably null	Het
BC005561	A	G	5: 104,518,777	I388M	probably benign	Het
Bzw2	C	T	12: 36,107,525	V314I	possibly damaging	Het
Capn13	A	T	17: 73,365,959	Y116*	probably null	Het
Clca4b	A	G	3: 144,919,275	I485T	probably benign	Het
Crybg3	T	A	16: 59,495,690	T1130S	possibly damaging	Het
Cubn	C	T	2: 13,294,203	V3220M	probably damaging	Het
Cyp4f16	T	A	17: 32,551,199	L514Q	probably damaging	Het
D7Ertd443e	G	T	7: 134,349,711	Q31K	probably benign	Het
Dcaf15	T	C	8: 84,104,726	E8G	probably benign	Het
Ddx24	A	C	12: 103,425,560		probably benign	Het
Diaph3	T	C	14: 86,828,994	M988V	possibly damaging	Het
Dlx4	A	G	11: 95,145,252	V77A	probably benign	Het
Dnah3	T	C	7: 119,922,968		probably null	Het
Drc1	A	G	5: 30,356,288	E396G	probably benign	Het
Gab1	C	A	8: 80,788,597	R364L	possibly damaging	Het
Gbp2b	T	C	3: 142,618,138	L568S	probably benign	Het
Gjb5	A	T	4: 127,356,147	F68Y	probably benign	Het
Gm17359	A	G	3: 79,449,399	R170G	probably benign	Het
Gm9008	A	G	6: 76,496,458	C392R	probably damaging	Het
Hs6st3	C	A	14: 119,138,634	P74T	probably benign	Het
Kif26b	T	C	1: 178,917,568	L1743P	probably damaging	Het
Lnx1	A	T	5: 74,685,646	C48S	probably damaging	Het
Lrfn2	A	G	17: 49,070,626	H245R	probably damaging	Het
Lrrc27	A	G	7: 139,218,268	E93G	probably benign	Het
Mettl6	T	C	14: 31,479,726	E253G	probably damaging	Het
Nmu	A	T	5: 76,343,971	F106Y	probably damaging	Het
Pcsk7	T	C	9: 45,909,696	I142T	probably benign	Het
Polr3a	A	T	14: 24,486,871		probably null	Het
Psmb9	G	T	17: 34,185,733	A19E	probably damaging	Het
Pus7l	A	G	15: 94,531,575	M454T	probably benign	Het
Raet1e	A	G	10: 22,180,746	T74A	probably benign	Het
Ralb	A	C	1: 119,478,109	Y43*	probably null	Het
Ralgapa1	C	A	12: 55,683,910	E1947*	probably null	Het
Robo1	T	C	16: 72,972,046	Y500H	probably benign	Het
Shroom1	A	C	11: 53,463,387	T45P	probably benign	Het
Slit2	A	G	5: 47,984,986		probably benign	Het
Srgap3	T	C	6: 112,723,006	S1004G	probably damaging	Het
Taok2	A	G	7: 126,870,992	V888A	probably benign	Het
Tbc1d8	T	A	1: 39,402,899	D204V	probably damaging	Het
Trav7d-4	C	A	14: 52,770,167	A39D	probably damaging	Het
Ush2a	G	T	1: 188,267,032	E180*	probably null	Het
Vmn1r37	A	G	6: 66,731,579	D63G	probably benign	Het
Zfp282	G	A	6: 47,880,385	R184Q	probably damaging	Het

Other mutations in Brdt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02342:Brdt	APN	5	107342203	missense	probably damaging	1.00
IGL02718:Brdt	APN	5	107350068	splice site	probably benign
IGL02746:Brdt	APN	5	107370324	missense	probably benign
IGL02851:Brdt	APN	5	107377995	missense	possibly damaging	0.47
R0585:Brdt	UTSW	5	107356882	critical splice donor site	probably null
R0708:Brdt	UTSW	5	107358900	nonsense	probably null
R1338:Brdt	UTSW	5	107350188	missense	probably benign	0.02
R1710:Brdt	UTSW	5	107343584	missense	probably damaging	1.00
R1794:Brdt	UTSW	5	107359853	small deletion	probably benign
R1861:Brdt	UTSW	5	107359458	missense	probably benign
R1913:Brdt	UTSW	5	107348613	missense	probably benign
R2029:Brdt	UTSW	5	107359224	missense	probably benign	0.35
R2431:Brdt	UTSW	5	107378015	splice site	probably null
R3121:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R3122:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R4258:Brdt	UTSW	5	107359909	missense	probably damaging	0.97
R4609:Brdt	UTSW	5	107359936	missense	probably benign	0.00
R5306:Brdt	UTSW	5	107345144	missense	probably damaging	1.00
R5640:Brdt	UTSW	5	107359308	nonsense	probably null
R5677:Brdt	UTSW	5	107348617	missense	possibly damaging	0.85
R5936:Brdt	UTSW	5	107359395	missense	probably damaging	1.00
R6145:Brdt	UTSW	5	107377999	missense	possibly damaging	0.67
R6261:Brdt	UTSW	5	107348503	missense	probably benign	0.04
R6930:Brdt	UTSW	5	107359215	missense	probably benign	0.35
R7372:Brdt	UTSW	5	107370294	missense	possibly damaging	0.49
R7741:Brdt	UTSW	5	107358886	missense	probably benign	0.00
R7842:Brdt	UTSW	5	107348588	missense	possibly damaging	0.49
R7869:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R7887:Brdt	UTSW	5	107359933	missense	possibly damaging	0.66
R7972:Brdt	UTSW	5	107348549	missense	possibly damaging	0.53
R8064:Brdt	UTSW	5	107377996	nonsense	probably null
R8958:Brdt	UTSW	5	107378011	missense	probably benign
R9199:Brdt	UTSW	5	107350163	nonsense	probably null
R9346:Brdt	UTSW	5	107377014	missense	probably damaging	0.99
X0011:Brdt	UTSW	5	107342128	missense	probably damaging	0.96
X0011:Brdt	UTSW	5	107377092	missense	probably damaging	1.00
Z1176:Brdt	UTSW	5	107359898	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- CCCTAAGTACTGAGAGGTTCTTCTTAG -3'
(R):5'- TTACATCACTGACAGTCCTCTTTAGG -3'

Sequencing Primer
(F):5'- GTTGGAGAATTGAACTTCACATCTAC -3'
(R):5'- GGCAGTCAGAACACAATC -3'

Posted On

2018-05-04