Incidental Mutation 'R6408:Srgap3'
ID514535
Institutional Source Beutler Lab
Gene Symbol Srgap3
Ensembl Gene ENSMUSG00000030257
Gene NameSLIT-ROBO Rho GTPase activating protein 3
SynonymsD130026O08Rik, Arhgap14
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R6408 (G1)
Quality Score182.009
Status Validated
Chromosome6
Chromosomal Location112717971-112947266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112723006 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1004 (S1004G)
Ref Sequence ENSEMBL: ENSMUSP00000108794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088373] [ENSMUST00000113169]
Predicted Effect probably damaging
Transcript: ENSMUST00000088373
AA Change: S1028G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085712
Gene: ENSMUSG00000030257
AA Change: S1028G

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
RhoGAP 517 691 7.43e-66 SMART
SH3 747 802 9.69e-15 SMART
coiled coil region 955 985 N/A INTRINSIC
low complexity region 1025 1038 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113169
AA Change: S1004G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108794
Gene: ENSMUSG00000030257
AA Change: S1004G

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
Blast:RhoGAP 434 474 4e-11 BLAST
low complexity region 476 488 N/A INTRINSIC
RhoGAP 493 667 7.43e-66 SMART
SH3 723 778 9.69e-15 SMART
coiled coil region 931 961 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in spine density in the brain CA1 and cortical layers IV/V. Mice homozygous for a different knock-out allele exhibit a neurodevelopment disorder with schizophrenia-related intermediate phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Srgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Srgap3 APN 6 112739397 missense probably damaging 0.98
IGL01325:Srgap3 APN 6 112775686 missense probably damaging 1.00
IGL01608:Srgap3 APN 6 112946478 missense probably benign 0.00
IGL01626:Srgap3 APN 6 112773648 missense probably damaging 0.98
IGL01787:Srgap3 APN 6 112723022 missense probably benign 0.00
IGL02698:Srgap3 APN 6 112746928 missense probably damaging 0.98
IGL02805:Srgap3 APN 6 112727263 missense probably damaging 0.99
IGL02813:Srgap3 APN 6 112731480 missense probably damaging 1.00
IGL02876:Srgap3 APN 6 112771453 missense probably damaging 1.00
IGL03264:Srgap3 APN 6 112816675 missense probably damaging 1.00
IGL03342:Srgap3 APN 6 112775687 missense probably damaging 1.00
R0007:Srgap3 UTSW 6 112829512 missense probably damaging 1.00
R0371:Srgap3 UTSW 6 112771471 missense probably damaging 0.99
R0607:Srgap3 UTSW 6 112723119 missense probably damaging 1.00
R1628:Srgap3 UTSW 6 112739370 missense probably damaging 0.99
R1669:Srgap3 UTSW 6 112722904 missense probably benign 0.36
R1858:Srgap3 UTSW 6 112771518 missense probably damaging 1.00
R1876:Srgap3 UTSW 6 112775566 missense probably damaging 0.98
R1896:Srgap3 UTSW 6 112738997 missense probably benign 0.11
R2159:Srgap3 UTSW 6 112771378 missense probably damaging 0.99
R2221:Srgap3 UTSW 6 112946493 missense probably damaging 0.98
R2862:Srgap3 UTSW 6 112722972 missense probably damaging 0.99
R3160:Srgap3 UTSW 6 112729658 missense probably benign 0.00
R3162:Srgap3 UTSW 6 112729658 missense probably benign 0.00
R4092:Srgap3 UTSW 6 112723084 missense probably benign 0.00
R4561:Srgap3 UTSW 6 112781054 missense probably damaging 0.98
R4781:Srgap3 UTSW 6 112757425 intron probably benign
R4825:Srgap3 UTSW 6 112727310 missense probably benign
R4887:Srgap3 UTSW 6 112746934 missense probably damaging 1.00
R5304:Srgap3 UTSW 6 112766939 missense probably damaging 1.00
R5556:Srgap3 UTSW 6 112739078 missense probably damaging 0.99
R5672:Srgap3 UTSW 6 112775561 missense probably benign
R5879:Srgap3 UTSW 6 112722846 missense possibly damaging 0.67
R5944:Srgap3 UTSW 6 112795814 missense possibly damaging 0.89
R6277:Srgap3 UTSW 6 112739383 missense probably benign 0.02
R6298:Srgap3 UTSW 6 112816610 missense probably damaging 0.98
R6407:Srgap3 UTSW 6 112723006 missense probably damaging 0.99
R6797:Srgap3 UTSW 6 112829542 missense probably damaging 1.00
R6852:Srgap3 UTSW 6 112816661 missense probably damaging 1.00
R6965:Srgap3 UTSW 6 112723129 missense probably damaging 1.00
R7055:Srgap3 UTSW 6 112746963 missense probably damaging 0.97
R7067:Srgap3 UTSW 6 112757305 intron probably benign
R7361:Srgap3 UTSW 6 112746921 missense probably damaging 0.99
R7479:Srgap3 UTSW 6 112735833 critical splice donor site probably null
R7606:Srgap3 UTSW 6 112739376 missense probably benign 0.00
R7731:Srgap3 UTSW 6 112766897 missense probably benign 0.36
R7787:Srgap3 UTSW 6 112775559 missense probably benign 0.02
R7990:Srgap3 UTSW 6 112739427 splice site probably null
R8026:Srgap3 UTSW 6 112739364 missense not run
R8040:Srgap3 UTSW 6 112739364 missense not run
R8066:Srgap3 UTSW 6 112771378 missense probably damaging 0.99
R8067:Srgap3 UTSW 6 112739364 missense not run
X0062:Srgap3 UTSW 6 112795786 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTGTCCGAGGAGCTATTAGG -3'
(R):5'- CCTCTAGGACATCGAGAAGACC -3'

Sequencing Primer
(F):5'- GGAGCTATTAGGGAACATCTTCTCC -3'
(R):5'- CTCTAGGACATCGAGAAGACCATGAG -3'
Posted On2018-05-04