Incidental Mutation 'R6408:Lrrc27'
ID 514539
Institutional Source Beutler Lab
Gene Symbol Lrrc27
Ensembl Gene ENSMUSG00000015980
Gene Name leucine rich repeat containing 27
Synonyms 2310044E02Rik, 1700071K18Rik
MMRRC Submission 044553-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R6408 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 138792904-138822895 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 138798184 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 93 (E93G)
Ref Sequence ENSEMBL: ENSMUSP00000116624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016124] [ENSMUST00000106104] [ENSMUST00000135509] [ENSMUST00000156768] [ENSMUST00000165870]
AlphaFold Q80YS5
Predicted Effect probably benign
Transcript: ENSMUST00000016124
AA Change: E93G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000016124
Gene: ENSMUSG00000015980
AA Change: E93G

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
LRR_TYP 75 98 1.03e-2 SMART
LRR_TYP 99 122 3.69e-4 SMART
LRR 123 145 7.38e1 SMART
low complexity region 271 283 N/A INTRINSIC
coiled coil region 336 370 N/A INTRINSIC
coiled coil region 463 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106104
AA Change: E93G

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101710
Gene: ENSMUSG00000015980
AA Change: E93G

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
LRR_TYP 75 98 1.03e-2 SMART
LRR_TYP 99 122 3.69e-4 SMART
LRR 123 145 7.38e1 SMART
low complexity region 271 283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130248
Predicted Effect silent
Transcript: ENSMUST00000135509
SMART Domains Protein: ENSMUSP00000116827
Gene: ENSMUSG00000015980

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156768
AA Change: E93G

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116624
Gene: ENSMUSG00000015980
AA Change: E93G

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
LRR_TYP 75 98 1.03e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165870
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,691,858 (GRCm39) S50P probably damaging Het
4930407I10Rik T C 15: 81,949,307 (GRCm39) V1068A possibly damaging Het
Acss1 A G 2: 150,470,412 (GRCm39) probably null Het
Amer2 T C 14: 60,617,674 (GRCm39) I497T probably damaging Het
Azi2 A T 9: 117,890,550 (GRCm39) R51* probably null Het
Brdt A G 5: 107,533,358 (GRCm39) D946G probably damaging Het
Bzw2 C T 12: 36,157,524 (GRCm39) V314I possibly damaging Het
Capn13 A T 17: 73,672,954 (GRCm39) Y116* probably null Het
Clca4b A G 3: 144,625,036 (GRCm39) I485T probably benign Het
Crybg3 T A 16: 59,316,053 (GRCm39) T1130S possibly damaging Het
Cubn C T 2: 13,299,014 (GRCm39) V3220M probably damaging Het
Cyp4f16 T A 17: 32,770,173 (GRCm39) L514Q probably damaging Het
D7Ertd443e G T 7: 133,951,440 (GRCm39) Q31K probably benign Het
Dcaf15 T C 8: 84,831,355 (GRCm39) E8G probably benign Het
Ddx24 A C 12: 103,391,819 (GRCm39) probably benign Het
Diaph3 T C 14: 87,066,430 (GRCm39) M988V possibly damaging Het
Dlx4 A G 11: 95,036,078 (GRCm39) V77A probably benign Het
Dnah3 T C 7: 119,522,191 (GRCm39) probably null Het
Drc1 A G 5: 30,513,632 (GRCm39) E396G probably benign Het
Gab1 C A 8: 81,515,226 (GRCm39) R364L possibly damaging Het
Gbp2b T C 3: 142,323,899 (GRCm39) L568S probably benign Het
Gjb5 A T 4: 127,249,940 (GRCm39) F68Y probably benign Het
Hs6st3 C A 14: 119,376,046 (GRCm39) P74T probably benign Het
Kif26b T C 1: 178,745,133 (GRCm39) L1743P probably damaging Het
Lnx1 A T 5: 74,846,307 (GRCm39) C48S probably damaging Het
Lrfn2 A G 17: 49,377,654 (GRCm39) H245R probably damaging Het
Mettl6 T C 14: 31,201,683 (GRCm39) E253G probably damaging Het
Nmu A T 5: 76,491,818 (GRCm39) F106Y probably damaging Het
Pcsk7 T C 9: 45,820,994 (GRCm39) I142T probably benign Het
Polr3a A T 14: 24,536,939 (GRCm39) probably null Het
Psmb9 G T 17: 34,404,707 (GRCm39) A19E probably damaging Het
Pus7l A G 15: 94,429,456 (GRCm39) M454T probably benign Het
Raet1e A G 10: 22,056,645 (GRCm39) T74A probably benign Het
Ralb A C 1: 119,405,839 (GRCm39) Y43* probably null Het
Ralgapa1 C A 12: 55,730,695 (GRCm39) E1947* probably null Het
Rnf26rt A G 6: 76,473,441 (GRCm39) C392R probably damaging Het
Robo1 T C 16: 72,768,934 (GRCm39) Y500H probably benign Het
Shroom1 A C 11: 53,354,214 (GRCm39) T45P probably benign Het
Slit2 A G 5: 48,142,328 (GRCm39) probably benign Het
Spmip2 A G 3: 79,356,706 (GRCm39) R170G probably benign Het
Srgap3 T C 6: 112,699,967 (GRCm39) S1004G probably damaging Het
Taok2 A G 7: 126,470,164 (GRCm39) V888A probably benign Het
Tbc1d8 T A 1: 39,441,980 (GRCm39) D204V probably damaging Het
Thoc2l A G 5: 104,666,643 (GRCm39) I388M probably benign Het
Trav7d-4 C A 14: 53,007,624 (GRCm39) A39D probably damaging Het
Ush2a G T 1: 187,999,229 (GRCm39) E180* probably null Het
Vmn1r37 A G 6: 66,708,563 (GRCm39) D63G probably benign Het
Zfp282 G A 6: 47,857,319 (GRCm39) R184Q probably damaging Het
Other mutations in Lrrc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Lrrc27 APN 7 138,807,827 (GRCm39) intron probably benign
IGL02095:Lrrc27 APN 7 138,810,169 (GRCm39) missense probably benign 0.04
IGL02489:Lrrc27 APN 7 138,805,977 (GRCm39) missense probably benign 0.01
IGL03080:Lrrc27 APN 7 138,810,153 (GRCm39) missense probably benign 0.03
R0372:Lrrc27 UTSW 7 138,806,103 (GRCm39) missense probably benign 0.17
R1466:Lrrc27 UTSW 7 138,810,224 (GRCm39) unclassified probably benign
R2401:Lrrc27 UTSW 7 138,803,529 (GRCm39) missense probably damaging 1.00
R2876:Lrrc27 UTSW 7 138,808,600 (GRCm39) intron probably benign
R3113:Lrrc27 UTSW 7 138,798,223 (GRCm39) missense probably damaging 1.00
R4214:Lrrc27 UTSW 7 138,803,609 (GRCm39) missense probably damaging 1.00
R4707:Lrrc27 UTSW 7 138,822,614 (GRCm39) missense probably benign 0.02
R4784:Lrrc27 UTSW 7 138,822,614 (GRCm39) missense probably benign 0.02
R5070:Lrrc27 UTSW 7 138,794,715 (GRCm39) missense probably damaging 0.99
R5855:Lrrc27 UTSW 7 138,798,251 (GRCm39) unclassified probably benign
R6993:Lrrc27 UTSW 7 138,822,540 (GRCm39) missense probably damaging 0.99
R7332:Lrrc27 UTSW 7 138,822,661 (GRCm39) missense probably damaging 1.00
R7350:Lrrc27 UTSW 7 138,806,022 (GRCm39) missense probably benign 0.01
R7460:Lrrc27 UTSW 7 138,803,574 (GRCm39) missense probably damaging 1.00
R7502:Lrrc27 UTSW 7 138,794,748 (GRCm39) missense probably benign
R8020:Lrrc27 UTSW 7 138,816,793 (GRCm39) missense probably damaging 1.00
R8071:Lrrc27 UTSW 7 138,816,902 (GRCm39) missense probably benign 0.01
R8518:Lrrc27 UTSW 7 138,808,690 (GRCm39) missense probably benign 0.01
R8728:Lrrc27 UTSW 7 138,822,555 (GRCm39) missense probably damaging 1.00
R8734:Lrrc27 UTSW 7 138,796,515 (GRCm39) unclassified probably benign
R9141:Lrrc27 UTSW 7 138,807,861 (GRCm39) missense probably benign 0.03
R9355:Lrrc27 UTSW 7 138,822,648 (GRCm39) missense probably damaging 0.98
R9387:Lrrc27 UTSW 7 138,807,837 (GRCm39) nonsense probably null
R9627:Lrrc27 UTSW 7 138,808,582 (GRCm39) intron probably benign
R9742:Lrrc27 UTSW 7 138,806,229 (GRCm39) missense probably benign 0.39
R9779:Lrrc27 UTSW 7 138,816,886 (GRCm39) missense possibly damaging 0.95
R9800:Lrrc27 UTSW 7 138,807,913 (GRCm39) missense probably benign 0.16
RF018:Lrrc27 UTSW 7 138,806,016 (GRCm39) missense probably benign 0.03
X0065:Lrrc27 UTSW 7 138,810,162 (GRCm39) missense probably benign 0.00
X0065:Lrrc27 UTSW 7 138,810,161 (GRCm39) missense probably benign 0.00
Z1176:Lrrc27 UTSW 7 138,822,636 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCTGAGTGTAGCCAGAG -3'
(R):5'- TGCACTTTGAACCATCTGGAC -3'

Sequencing Primer
(F):5'- TTTGCTGAGTGTAGCCAGAGAGAAG -3'
(R):5'- TTACGTAGACCAAGTTGGCC -3'
Posted On 2018-05-04