Incidental Mutation 'R6408:Dcaf15'
ID514541
Institutional Source Beutler Lab
Gene Symbol Dcaf15
Ensembl Gene ENSMUSG00000037103
Gene NameDDB1 and CUL4 associated factor 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R6408 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location84097072-84104768 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84104726 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 8 (E8G)
Ref Sequence ENSEMBL: ENSMUSP00000147690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041367] [ENSMUST00000210279] [ENSMUST00000210625]
Predicted Effect probably benign
Transcript: ENSMUST00000041367
AA Change: E8G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000038568
Gene: ENSMUSG00000037103
AA Change: E8G

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:DCAF15_WD40 48 259 1.1e-84 PFAM
low complexity region 275 294 N/A INTRINSIC
low complexity region 343 359 N/A INTRINSIC
low complexity region 374 384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210279
AA Change: E8G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect unknown
Transcript: ENSMUST00000210625
AA Change: E8G
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Dcaf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Dcaf15 APN 8 84098397 missense probably damaging 0.98
IGL01455:Dcaf15 APN 8 84098590 missense probably benign
IGL01656:Dcaf15 APN 8 84097988 missense probably benign 0.01
IGL02437:Dcaf15 APN 8 84101816 missense probably damaging 1.00
IGL02718:Dcaf15 APN 8 84098376 missense possibly damaging 0.52
R2072:Dcaf15 UTSW 8 84101741 missense probably damaging 1.00
R2090:Dcaf15 UTSW 8 84097771 nonsense probably null
R3913:Dcaf15 UTSW 8 84099165 missense probably damaging 1.00
R4582:Dcaf15 UTSW 8 84097969 missense probably damaging 1.00
R4657:Dcaf15 UTSW 8 84102838 missense probably damaging 0.99
R4714:Dcaf15 UTSW 8 84102216 missense probably benign 0.21
R4734:Dcaf15 UTSW 8 84097728 missense probably benign 0.00
R5898:Dcaf15 UTSW 8 84098452 missense probably damaging 1.00
R6167:Dcaf15 UTSW 8 84097997 missense possibly damaging 0.78
R6261:Dcaf15 UTSW 8 84099105 missense probably benign
R7248:Dcaf15 UTSW 8 84102765 missense possibly damaging 0.89
R7498:Dcaf15 UTSW 8 84101763 missense probably damaging 1.00
Z1088:Dcaf15 UTSW 8 84102781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGCTGCACACAAGTCAC -3'
(R):5'- TAGCTTTGATGGACAAGCGTAG -3'

Sequencing Primer
(F):5'- GTCACCAACCTTCGCCAG -3'
(R):5'- GCGGGAAGCGACAAGGAATG -3'
Posted On2018-05-04