Incidental Mutation 'R6408:Pcsk7'
ID514542
Institutional Source Beutler Lab
Gene Symbol Pcsk7
Ensembl Gene ENSMUSG00000035382
Gene Nameproprotein convertase subtilisin/kexin type 7
SynonymsSPC7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6408 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location45906497-45929726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45909696 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 142 (I142T)
Ref Sequence ENSEMBL: ENSMUSP00000150393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039059] [ENSMUST00000058720] [ENSMUST00000160699] [ENSMUST00000160811] [ENSMUST00000161187] [ENSMUST00000161203] [ENSMUST00000162369] [ENSMUST00000162699] [ENSMUST00000213659] [ENSMUST00000213854] [ENSMUST00000215189] [ENSMUST00000216672]
Predicted Effect probably benign
Transcript: ENSMUST00000039059
AA Change: I142T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047508
Gene: ENSMUSG00000035382
AA Change: I142T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:S8_pro-domain 52 140 9.7e-21 PFAM
Pfam:Peptidase_S8 177 464 4.7e-43 PFAM
Pfam:P_proprotein 524 611 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058720
SMART Domains Protein: ENSMUSP00000060941
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160699
SMART Domains Protein: ENSMUSP00000123754
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160811
Predicted Effect probably benign
Transcript: ENSMUST00000161187
SMART Domains Protein: ENSMUSP00000124296
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
coiled coil region 65 224 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 465 509 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161203
SMART Domains Protein: ENSMUSP00000123995
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
SCOP:d1eq1a_ 80 227 2e-5 SMART
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 500 544 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162369
Predicted Effect probably benign
Transcript: ENSMUST00000162699
Predicted Effect probably benign
Transcript: ENSMUST00000213659
Predicted Effect probably benign
Transcript: ENSMUST00000213854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215005
Predicted Effect probably benign
Transcript: ENSMUST00000215189
AA Change: I142T

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215535
Predicted Effect probably benign
Transcript: ENSMUST00000216672
AA Change: I142T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. It encodes a type 1 membrane bound protease that is expressed in many tissues, including neuroendocrine, liver, gut, and brain. The encoded protein undergoes an initial autocatalytic processing event in the ER and then sorts to the trans-Golgi network through endosomes where a second autocatalytic event takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It can process proalbumin and is thought to be responsible for the activation of HIV envelope glycoproteins gp160 and gp140. This gene has been implicated in the transcriptional regulation of housekeeping genes and plays a role in the regulation of iron metabolism. A t(11;14)(q23;q32) chromosome translocation associated with B-cell lymphoma occurs between this gene and its inverted counterpart. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Pcsk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Pcsk7 APN 9 45927660 missense probably benign
IGL01081:Pcsk7 APN 9 45928707 missense probably benign
IGL02634:Pcsk7 APN 9 45919262 missense possibly damaging 0.87
IGL02999:Pcsk7 APN 9 45927599 missense possibly damaging 0.68
IGL03115:Pcsk7 APN 9 45914372 missense probably damaging 1.00
IGL03149:Pcsk7 APN 9 45909480 missense probably benign 0.37
R0243:Pcsk7 UTSW 9 45916059 missense probably damaging 1.00
R0324:Pcsk7 UTSW 9 45913011 missense possibly damaging 0.87
R0947:Pcsk7 UTSW 9 45911172 missense probably damaging 1.00
R1443:Pcsk7 UTSW 9 45925986 missense probably damaging 1.00
R1545:Pcsk7 UTSW 9 45914348 missense probably damaging 1.00
R2182:Pcsk7 UTSW 9 45928619 missense probably benign
R2939:Pcsk7 UTSW 9 45916024 missense probably damaging 1.00
R3739:Pcsk7 UTSW 9 45926759 missense possibly damaging 0.72
R4039:Pcsk7 UTSW 9 45928007 splice site probably null
R4348:Pcsk7 UTSW 9 45919348 missense probably damaging 1.00
R4974:Pcsk7 UTSW 9 45918862 missense probably damaging 1.00
R5817:Pcsk7 UTSW 9 45926033 missense probably benign 0.01
R6214:Pcsk7 UTSW 9 45910376 missense possibly damaging 0.47
R6215:Pcsk7 UTSW 9 45910376 missense possibly damaging 0.47
R7338:Pcsk7 UTSW 9 45925989 missense probably benign 0.03
R7355:Pcsk7 UTSW 9 45909374 missense probably benign 0.03
R7475:Pcsk7 UTSW 9 45927625 missense probably damaging 1.00
R7540:Pcsk7 UTSW 9 45927673 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTGGACAGCCTAGAAGGTGAG -3'
(R):5'- TCTTCACAGCAGACAGGGAAG -3'

Sequencing Primer
(F):5'- CAGCAGGGCTTGTGAATGC -3'
(R):5'- TTCACAGCAGACAGGGAAGGTATG -3'
Posted On2018-05-04