Incidental Mutation 'R6408:Raet1e'
ID514544
Institutional Source Beutler Lab
Gene Symbol Raet1e
Ensembl Gene ENSMUSG00000053219
Gene Nameretinoic acid early transcript 1E
SynonymsRae-1 epsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock #R6408 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location22158569-22374139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22180746 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 74 (T74A)
Ref Sequence ENSEMBL: ENSMUSP00000138022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065527] [ENSMUST00000105522] [ENSMUST00000178026] [ENSMUST00000180648] [ENSMUST00000181645]
Predicted Effect probably benign
Transcript: ENSMUST00000065527
AA Change: T74A

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066627
Gene: ENSMUSG00000053219
AA Change: T74A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 1e-121 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105522
SMART Domains Protein: ENSMUSP00000101161
Gene: ENSMUSG00000075297

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PDB:4G59|B 29 195 2e-9 PDB
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178026
AA Change: T74A

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136032
Gene: ENSMUSG00000053219
AA Change: T74A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 7.3e-112 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180648
SMART Domains Protein: ENSMUSP00000137946
Gene: ENSMUSG00000053219

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 66 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181645
AA Change: T74A

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138022
Gene: ENSMUSG00000053219
AA Change: T74A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 1e-121 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Raet1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Raet1e APN 10 22181320 missense probably damaging 1.00
IGL02406:Raet1e APN 10 22180636 missense probably damaging 1.00
IGL02484:Raet1e APN 10 22180767 missense probably benign 0.01
R0049:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0238:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0238:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0239:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0639:Raet1e UTSW 10 22174375 missense probably damaging 0.99
R0885:Raet1e UTSW 10 22182087 unclassified probably benign
R3704:Raet1e UTSW 10 22180845 missense probably benign 0.20
R4764:Raet1e UTSW 10 22181332 missense probably damaging 1.00
R4799:Raet1e UTSW 10 22181300 missense probably damaging 1.00
R5566:Raet1e UTSW 10 22174405 missense probably damaging 1.00
R6034:Raet1e UTSW 10 22182091 makesense probably null
R6034:Raet1e UTSW 10 22182091 makesense probably null
R6077:Raet1e UTSW 10 22181988 missense possibly damaging 0.72
R6238:Raet1e UTSW 10 22180871 missense probably benign 0.01
R6939:Raet1e UTSW 10 22174357 missense possibly damaging 0.86
R7147:Raet1e UTSW 10 22181280 missense probably benign 0.29
Z1088:Raet1e UTSW 10 22181951 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GGGATCACAGAAACATGAGTCC -3'
(R):5'- AATGCTCAGCTCCTTCACAC -3'

Sequencing Primer
(F):5'- CAGAAACATGAGTCCTATGGCTTTC -3'
(R):5'- ACATTCCTGCATGTACTCTGC -3'
Posted On2018-05-04