Incidental Mutation 'R6408:Capn13'
ID514563
Institutional Source Beutler Lab
Gene Symbol Capn13
Ensembl Gene ENSMUSG00000043705
Gene Namecalpain 13
SynonymsLOC381122
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6408 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location73306464-73399296 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 73365959 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 116 (Y116*)
Ref Sequence ENSEMBL: ENSMUSP00000092832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095208]
Predicted Effect probably null
Transcript: ENSMUST00000095208
AA Change: Y116*
SMART Domains Protein: ENSMUSP00000092832
Gene: ENSMUSG00000043705
AA Change: Y116*

DomainStartEndE-ValueType
CysPc 12 337 3.23e-113 SMART
Pfam:Calpain_III 341 473 2e-13 PFAM
SCOP:d1k94a_ 512 664 3e-8 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Capn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Capn13 APN 17 73339425 missense possibly damaging 0.82
IGL01099:Capn13 APN 17 73351509 missense probably damaging 0.99
IGL01613:Capn13 APN 17 73331058 missense probably benign 0.07
IGL02215:Capn13 APN 17 73330998 missense probably damaging 1.00
IGL02403:Capn13 APN 17 73351426 missense possibly damaging 0.82
IGL02877:Capn13 APN 17 73322055 missense probably damaging 0.97
IGL03113:Capn13 APN 17 73331113 missense probably benign 0.00
IGL03246:Capn13 APN 17 73382860 missense probably benign
IGL03369:Capn13 APN 17 73341154 splice site probably benign
R0116:Capn13 UTSW 17 73351524 missense probably damaging 1.00
R0729:Capn13 UTSW 17 73322069 missense probably damaging 1.00
R0745:Capn13 UTSW 17 73351508 missense probably benign 0.39
R0746:Capn13 UTSW 17 73351508 missense probably benign 0.39
R0778:Capn13 UTSW 17 73351508 missense probably benign 0.39
R1252:Capn13 UTSW 17 73367227 missense possibly damaging 0.80
R1594:Capn13 UTSW 17 73351479 missense probably benign 0.15
R1641:Capn13 UTSW 17 73382894 missense possibly damaging 0.91
R1895:Capn13 UTSW 17 73350525 missense possibly damaging 0.50
R1902:Capn13 UTSW 17 73326361 missense probably damaging 1.00
R1946:Capn13 UTSW 17 73350525 missense possibly damaging 0.50
R2184:Capn13 UTSW 17 73365948 missense probably damaging 1.00
R2427:Capn13 UTSW 17 73326317 splice site probably benign
R2963:Capn13 UTSW 17 73315263 critical splice donor site probably null
R3755:Capn13 UTSW 17 73331119 nonsense probably null
R3759:Capn13 UTSW 17 73322077 missense probably benign 0.01
R3795:Capn13 UTSW 17 73337392 missense probably benign 0.14
R3801:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3802:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3803:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3804:Capn13 UTSW 17 73339401 missense probably benign 0.00
R4084:Capn13 UTSW 17 73337449 missense probably benign 0.00
R4194:Capn13 UTSW 17 73339484 missense possibly damaging 0.48
R4326:Capn13 UTSW 17 73331108 missense probably benign
R4788:Capn13 UTSW 17 73337432 nonsense probably null
R4852:Capn13 UTSW 17 73351506 frame shift probably null
R4853:Capn13 UTSW 17 73351506 frame shift probably null
R4855:Capn13 UTSW 17 73351506 frame shift probably null
R5063:Capn13 UTSW 17 73322079 nonsense probably null
R5112:Capn13 UTSW 17 73351506 frame shift probably null
R5438:Capn13 UTSW 17 73326484 missense probably benign
R5955:Capn13 UTSW 17 73331002 missense possibly damaging 0.92
R6512:Capn13 UTSW 17 73382990 missense probably benign 0.44
R7425:Capn13 UTSW 17 73318058 missense probably benign 0.13
R7605:Capn13 UTSW 17 73345137 critical splice donor site probably null
R7678:Capn13 UTSW 17 73315305 missense probably damaging 1.00
R7776:Capn13 UTSW 17 73322054 missense probably benign 0.07
R7791:Capn13 UTSW 17 73382888 missense possibly damaging 0.88
Z1176:Capn13 UTSW 17 73341110 missense not run
Predicted Primers PCR Primer
(F):5'- TGTGACTGGGCCATTAAAACAAAAC -3'
(R):5'- AGGGAGATTTGATATACAGAACCC -3'

Sequencing Primer
(F):5'- TGGGCCATTAAAACAAAACAAAAC -3'
(R):5'- CCATAAAATTTAGGGGGTGGGGTTTC -3'
Posted On2018-05-04