Incidental Mutation 'R6410:Nmt2'
ID514567
Institutional Source Beutler Lab
Gene Symbol Nmt2
Ensembl Gene ENSMUSG00000026643
Gene NameN-myristoyltransferase 2
SynonymshNMT-2, A930001K02Rik
MMRRC Submission 044383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R6410 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location3284212-3328877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3316178 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 341 (E341G)
Ref Sequence ENSEMBL: ENSMUSP00000080600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081932] [ENSMUST00000091504] [ENSMUST00000102989]
Predicted Effect probably damaging
Transcript: ENSMUST00000081932
AA Change: E341G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080600
Gene: ENSMUSG00000026643
AA Change: E341G

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
Pfam:NMT 170 327 1e-78 PFAM
Pfam:NMT_C 341 528 2.9e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091504
AA Change: E297G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089085
Gene: ENSMUSG00000026643
AA Change: E297G

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:NMT 124 283 2e-84 PFAM
Pfam:NMT_C 297 484 1.4e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102989
AA Change: E310G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100054
Gene: ENSMUSG00000026643
AA Change: E310G

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
Pfam:NMT 137 296 7.8e-85 PFAM
Pfam:NMT_C 310 497 6.4e-88 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two N-myristoyltransferase proteins. N-terminal myristoylation is a lipid modification that is involved in regulating the function and localization of signaling proteins. The encoded protein catalyzes the addition of a myristoyl group to the N-terminal glycine residue of many signaling proteins, including the human immunodeficiency virus type 1 (HIV-1) proteins, Gag and Nef. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in T cells exhibit reduced T cell, double positive T cell and single positive T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 C T 4: 133,062,899 R484W probably damaging Het
Arhgap24 T A 5: 102,892,151 I411N probably benign Het
Armt1 A G 10: 4,453,826 S304G probably benign Het
Atg9b T A 5: 24,386,110 N774I possibly damaging Het
C1s1 C T 6: 124,531,158 C624Y probably damaging Het
Camsap2 C A 1: 136,345,444 probably benign Het
Cd109 T C 9: 78,657,516 S248P probably benign Het
Cd28 A T 1: 60,765,283 H140L probably benign Het
Csmd3 G A 15: 48,673,407 T133I probably damaging Het
D430041D05Rik A T 2: 104,168,203 probably null Het
Defb47 T C 14: 63,000,993 V56A probably benign Het
Fxyd5 T C 7: 31,035,406 E132G probably damaging Het
H2-M2 A G 17: 37,483,213 V40A probably damaging Het
H2-Q7 T C 17: 35,440,176 L201P probably benign Het
Klra9 T G 6: 130,178,994 D266A probably damaging Het
Meioc A G 11: 102,675,034 N492S probably benign Het
Mgea5 T C 19: 45,776,045 probably null Het
Nutm1 A C 2: 112,248,729 V947G possibly damaging Het
Olfr873 T A 9: 20,300,452 I84N probably damaging Het
Pm20d1 G A 1: 131,798,596 G57D probably benign Het
Pnpla5 A G 15: 84,120,679 I157T probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sv2b A T 7: 75,140,109 I392N probably benign Het
Wfdc8 T A 2: 164,597,743 I240F probably benign Het
Other mutations in Nmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nmt2 APN 2 3314809 missense probably damaging 1.00
IGL00784:Nmt2 APN 2 3314809 missense probably damaging 1.00
IGL01871:Nmt2 APN 2 3312674 missense probably damaging 1.00
IGL02617:Nmt2 APN 2 3314713 missense probably benign 0.15
Faul UTSW 2 3305304 intron probably null
ANU05:Nmt2 UTSW 2 3314694 missense probably benign
R0278:Nmt2 UTSW 2 3325387 missense probably benign 0.00
R0524:Nmt2 UTSW 2 3305437 missense probably benign
R0743:Nmt2 UTSW 2 3314785 nonsense probably null
R0884:Nmt2 UTSW 2 3314785 nonsense probably null
R1895:Nmt2 UTSW 2 3322635 missense probably benign 0.11
R1946:Nmt2 UTSW 2 3322635 missense probably benign 0.11
R1957:Nmt2 UTSW 2 3325382 missense possibly damaging 0.95
R2037:Nmt2 UTSW 2 3309581 missense probably damaging 1.00
R2656:Nmt2 UTSW 2 3307013 missense probably benign
R3422:Nmt2 UTSW 2 3284388 missense possibly damaging 0.82
R3835:Nmt2 UTSW 2 3314686 splice site probably benign
R3955:Nmt2 UTSW 2 3312498 missense probably benign 0.00
R4701:Nmt2 UTSW 2 3322641 missense probably benign
R5032:Nmt2 UTSW 2 3284392 missense probably benign
R6373:Nmt2 UTSW 2 3324951 missense probably benign 0.05
R6396:Nmt2 UTSW 2 3314701 missense probably benign 0.18
R6863:Nmt2 UTSW 2 3305304 intron probably null
R6865:Nmt2 UTSW 2 3314729 missense probably damaging 1.00
R7100:Nmt2 UTSW 2 3312913 missense probably benign
R7139:Nmt2 UTSW 2 3284315 missense probably benign 0.01
R7516:Nmt2 UTSW 2 3312730 missense probably damaging 1.00
X0067:Nmt2 UTSW 2 3324961 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCCAAGATTCCAAAGGAGC -3'
(R):5'- CACAGCGTTCATTCCTGTTG -3'

Sequencing Primer
(F):5'- GGCCAAGATTCCAAAGGAGCATAAC -3'
(R):5'- GTTCATTCCTGTTGCAGCAG -3'
Posted On2018-05-04