Mutagenetix > Incidental Mutation

Incidental Mutation 'R6410:Wfdc8'

514570

Institutional Source

Beutler Lab

Gene Symbol

Wfdc8

Ensembl Gene

ENSMUSG00000070533

Gene Name

WAP four-disulfide core domain 8

Synonyms

LOC277343

MMRRC Submission

044383-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6410 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

164596458-164613626 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 164597743 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 240 (I240F)

Ref Sequence

ENSEMBL: ENSMUSP00000104963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094351] [ENSMUST00000103100] [ENSMUST00000109338] [ENSMUST00000109339]

AlphaFold

Q4KUS1

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083863

Predicted Effect

probably benign
Transcript: ENSMUST00000094351
AA Change: I240F

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000091911
Gene: ENSMUSG00000070533
AA Change: I240F

Domain	Start	End	E-Value	Type
low complexity region	54	65	N/A	INTRINSIC
WAP	79	123	1.88e-2	SMART
KU	125	178	8.81e-25	SMART
WAP	182	226	8.82e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000103100

SMART Domains

Protein: ENSMUSP00000099389
Gene: ENSMUSG00000017733

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
WAP	32	73	3.09e-3	SMART
KU	75	128	1.05e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109338

SMART Domains

Protein: ENSMUSP00000104962
Gene: ENSMUSG00000070533

Domain	Start	End	E-Value	Type
low complexity region	54	65	N/A	INTRINSIC
WAP	79	123	1.88e-2	SMART
KU	125	178	8.81e-25	SMART
WAP	182	226	8.82e-6	SMART
WAP	229	272	1.84e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109339
AA Change: I240F

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000104963
Gene: ENSMUSG00000070533
AA Change: I240F

Domain	Start	End	E-Value	Type
low complexity region	54	65	N/A	INTRINSIC
WAP	79	123	1.88e-2	SMART
KU	125	178	8.81e-25	SMART
WAP	182	226	8.82e-6	SMART
low complexity region	300	313	N/A	INTRINSIC
low complexity region	384	393	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. The encoded protein contains a Kunitz-inhibitor domain, in addition to three WFDC domains. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Two alternatively spliced transcript variants have been found for this gene, and they encode the same protein. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahdc1	C	T	4: 133,062,899	R484W	probably damaging	Het
Arhgap24	T	A	5: 102,892,151	I411N	probably benign	Het
Armt1	A	G	10: 4,453,826	S304G	probably benign	Het
Atg9b	T	A	5: 24,386,110	N774I	possibly damaging	Het
C1s1	C	T	6: 124,531,158	C624Y	probably damaging	Het
Camsap2	C	A	1: 136,345,444		probably benign	Het
Cd109	T	C	9: 78,657,516	S248P	probably benign	Het
Cd28	A	T	1: 60,765,283	H140L	probably benign	Het
Csmd3	G	A	15: 48,673,407	T133I	probably damaging	Het
D430041D05Rik	A	T	2: 104,168,203		probably null	Het
Defb47	T	C	14: 63,000,993	V56A	probably benign	Het
Fxyd5	T	C	7: 31,035,406	E132G	probably damaging	Het
H2-M2	A	G	17: 37,483,213	V40A	probably damaging	Het
H2-Q7	T	C	17: 35,440,176	L201P	probably benign	Het
Klra9	T	G	6: 130,178,994	D266A	probably damaging	Het
Meioc	A	G	11: 102,675,034	N492S	probably benign	Het
Mgea5	T	C	19: 45,776,045		probably null	Het
Nmt2	A	G	2: 3,316,178	E341G	probably damaging	Het
Nutm1	A	C	2: 112,248,729	V947G	possibly damaging	Het
Olfr873	T	A	9: 20,300,452	I84N	probably damaging	Het
Pm20d1	G	A	1: 131,798,596	G57D	probably benign	Het
Pnpla5	A	G	15: 84,120,679	I157T	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Sv2b	A	T	7: 75,140,109	I392N	probably benign	Het

Other mutations in Wfdc8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01896:Wfdc8	APN	2	164605780	missense	probably damaging	1.00
IGL02012:Wfdc8	APN	2	164603150	splice site	probably benign
IGL02831:Wfdc8	APN	2	164605765	critical splice donor site	probably null
PIT4131001:Wfdc8	UTSW	2	164597776	missense	possibly damaging	0.94
PIT4520001:Wfdc8	UTSW	2	164603303	missense	probably benign	0.09
R0006:Wfdc8	UTSW	2	164599064	missense	probably damaging	0.96
R0225:Wfdc8	UTSW	2	164597185	missense	probably benign	0.04
R0603:Wfdc8	UTSW	2	164603225	missense	probably damaging	1.00
R1741:Wfdc8	UTSW	2	164608869	unclassified	probably benign
R5484:Wfdc8	UTSW	2	164597729	missense	probably benign	0.11
R5546:Wfdc8	UTSW	2	164597319	utr 3 prime	probably benign
R5614:Wfdc8	UTSW	2	164603203	missense	probably damaging	1.00
R5668:Wfdc8	UTSW	2	164597419	utr 3 prime	probably benign
R6869:Wfdc8	UTSW	2	164599092	missense	possibly damaging	0.82
R7726:Wfdc8	UTSW	2	164599986	missense	possibly damaging	0.77
R7770:Wfdc8	UTSW	2	164597674	missense	unknown
R8150:Wfdc8	UTSW	2	164597535	nonsense	probably null
R8424:Wfdc8	UTSW	2	164603158	missense	probably benign	0.03
R8783:Wfdc8	UTSW	2	164605849	missense	probably benign	0.41
R9094:Wfdc8	UTSW	2	164597325	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGTCCATGGTGACCAGTGAG -3'
(R):5'- GTCTATATGGCAAGATCCAGGC -3'

Sequencing Primer
(F):5'- ATGGTGACCAGTGAGTCCCG -3'
(R):5'- CAGGCCAGCTAGCGATACATAATG -3'

Posted On

2018-05-04