Incidental Mutation 'R6410:Rsrc1'
ID514571
Institutional Source Beutler Lab
Gene Symbol Rsrc1
Ensembl Gene ENSMUSG00000034544
Gene Namearginine/serine-rich coiled-coil 1
Synonyms1200013F24Rik, SRrp53
MMRRC Submission 044383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6410 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location66981390-67358396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66994649 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 44 (P44L)
Ref Sequence ENSEMBL: ENSMUSP00000125547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046542] [ENSMUST00000065047] [ENSMUST00000065074] [ENSMUST00000160504] [ENSMUST00000161726] [ENSMUST00000162036] [ENSMUST00000162362] [ENSMUST00000162693]
Predicted Effect unknown
Transcript: ENSMUST00000046542
AA Change: P44L
SMART Domains Protein: ENSMUSP00000047077
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 116 N/A INTRINSIC
coiled coil region 138 191 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000065047
AA Change: P44L
SMART Domains Protein: ENSMUSP00000066967
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 109 N/A INTRINSIC
coiled coil region 122 175 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000065074
AA Change: P44L
SMART Domains Protein: ENSMUSP00000066797
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160504
AA Change: P44L
SMART Domains Protein: ENSMUSP00000124925
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 59 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161726
AA Change: P44L
SMART Domains Protein: ENSMUSP00000124347
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162036
AA Change: P44L
SMART Domains Protein: ENSMUSP00000125468
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162362
AA Change: P44L
SMART Domains Protein: ENSMUSP00000123699
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162620
Predicted Effect unknown
Transcript: ENSMUST00000162693
AA Change: P44L
SMART Domains Protein: ENSMUSP00000125547
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 88 N/A INTRINSIC
low complexity region 96 157 N/A INTRINSIC
coiled coil region 178 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182708
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine and arginine rich-related protein family. The encoded protein is involved in both constitutive and alternative mRNA splicing. This gene may be associated with schizophrenia. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 C T 4: 133,062,899 R484W probably damaging Het
Arhgap24 T A 5: 102,892,151 I411N probably benign Het
Armt1 A G 10: 4,453,826 S304G probably benign Het
Atg9b T A 5: 24,386,110 N774I possibly damaging Het
C1s1 C T 6: 124,531,158 C624Y probably damaging Het
Camsap2 C A 1: 136,345,444 probably benign Het
Cd109 T C 9: 78,657,516 S248P probably benign Het
Cd28 A T 1: 60,765,283 H140L probably benign Het
Csmd3 G A 15: 48,673,407 T133I probably damaging Het
D430041D05Rik A T 2: 104,168,203 probably null Het
Defb47 T C 14: 63,000,993 V56A probably benign Het
Fxyd5 T C 7: 31,035,406 E132G probably damaging Het
H2-M2 A G 17: 37,483,213 V40A probably damaging Het
H2-Q7 T C 17: 35,440,176 L201P probably benign Het
Klra9 T G 6: 130,178,994 D266A probably damaging Het
Meioc A G 11: 102,675,034 N492S probably benign Het
Mgea5 T C 19: 45,776,045 probably null Het
Nmt2 A G 2: 3,316,178 E341G probably damaging Het
Nutm1 A C 2: 112,248,729 V947G possibly damaging Het
Olfr873 T A 9: 20,300,452 I84N probably damaging Het
Pm20d1 G A 1: 131,798,596 G57D probably benign Het
Pnpla5 A G 15: 84,120,679 I157T probably damaging Het
Sv2b A T 7: 75,140,109 I392N probably benign Het
Wfdc8 T A 2: 164,597,743 I240F probably benign Het
Other mutations in Rsrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Rsrc1 APN 3 67082600 intron probably benign
IGL03180:Rsrc1 APN 3 67082543 intron probably benign
R0200:Rsrc1 UTSW 3 67180861 missense probably damaging 0.99
R0463:Rsrc1 UTSW 3 67180861 missense probably damaging 0.99
R1175:Rsrc1 UTSW 3 67356218 splice site probably benign
R1293:Rsrc1 UTSW 3 67356279 missense probably damaging 1.00
R1677:Rsrc1 UTSW 3 67355475 missense probably damaging 0.97
R1981:Rsrc1 UTSW 3 67350005 missense probably benign 0.18
R2039:Rsrc1 UTSW 3 66994618 missense unknown
R4222:Rsrc1 UTSW 3 66994567 missense unknown
R4624:Rsrc1 UTSW 3 67349978 missense probably damaging 1.00
R4852:Rsrc1 UTSW 3 67355602 missense probably damaging 1.00
R6102:Rsrc1 UTSW 3 66994649 missense unknown
R6103:Rsrc1 UTSW 3 66994649 missense unknown
R6104:Rsrc1 UTSW 3 66994649 missense unknown
R6127:Rsrc1 UTSW 3 66994649 missense unknown
R6129:Rsrc1 UTSW 3 66994649 missense unknown
R6153:Rsrc1 UTSW 3 67355562 missense probably benign 0.33
R6409:Rsrc1 UTSW 3 66994649 missense unknown
R6411:Rsrc1 UTSW 3 66994649 missense unknown
R6412:Rsrc1 UTSW 3 66994649 missense unknown
R6422:Rsrc1 UTSW 3 66994649 missense unknown
R6424:Rsrc1 UTSW 3 66994649 missense unknown
R6442:Rsrc1 UTSW 3 66994649 missense unknown
R6487:Rsrc1 UTSW 3 66994649 missense unknown
R6899:Rsrc1 UTSW 3 66994649 missense unknown
R6910:Rsrc1 UTSW 3 66994649 missense unknown
R6911:Rsrc1 UTSW 3 66994649 missense unknown
R6912:Rsrc1 UTSW 3 66994649 missense unknown
R6916:Rsrc1 UTSW 3 66994649 missense unknown
R6917:Rsrc1 UTSW 3 66994649 missense unknown
R6930:Rsrc1 UTSW 3 66994649 missense unknown
R6931:Rsrc1 UTSW 3 66994649 missense unknown
R6994:Rsrc1 UTSW 3 66994649 missense unknown
R6995:Rsrc1 UTSW 3 66994649 missense unknown
R6997:Rsrc1 UTSW 3 66994649 missense unknown
R7010:Rsrc1 UTSW 3 66994649 missense unknown
R7015:Rsrc1 UTSW 3 66994649 missense unknown
R7048:Rsrc1 UTSW 3 67180831 missense probably damaging 0.99
R7078:Rsrc1 UTSW 3 66994654 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGCCAAGCACATGTTAGTTT -3'
(R):5'- TGCTTTTGGGAGAAAGGTTGCA -3'

Sequencing Primer
(F):5'- GTTGGATCCAGGAGTTTACAGTCAAC -3'
(R):5'- TTTTGGGAGAAAGGTTGCAAAGGTAG -3'
Posted On2018-05-04