Incidental Mutation 'R6410:Olfr873'
ID514579
Institutional Source Beutler Lab
Gene Symbol Olfr873
Ensembl Gene ENSMUSG00000049028
Gene Nameolfactory receptor 873
SynonymsGA_x6K02T2PVTD-14040245-14041204, MOR145-2
MMRRC Submission 044383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R6410 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location20298532-20303599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20300452 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 84 (I84N)
Ref Sequence ENSEMBL: ENSMUSP00000153816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053919] [ENSMUST00000075717] [ENSMUST00000215540]
Predicted Effect probably damaging
Transcript: ENSMUST00000053919
AA Change: I81N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054778
Gene: ENSMUSG00000049028
AA Change: I81N

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 1.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 45 315 1.6e-8 PFAM
Pfam:7tm_1 51 300 3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075717
AA Change: I85N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075135
Gene: ENSMUSG00000049028
AA Change: I85N

DomainStartEndE-ValueType
Pfam:7tm_4 45 321 6.2e-43 PFAM
Pfam:7TM_GPCR_Srsx 49 309 3e-8 PFAM
Pfam:7tm_1 55 304 1.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213445
Predicted Effect probably damaging
Transcript: ENSMUST00000215540
AA Change: I84N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217193
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 C T 4: 133,062,899 R484W probably damaging Het
Arhgap24 T A 5: 102,892,151 I411N probably benign Het
Armt1 A G 10: 4,453,826 S304G probably benign Het
Atg9b T A 5: 24,386,110 N774I possibly damaging Het
C1s1 C T 6: 124,531,158 C624Y probably damaging Het
Camsap2 C A 1: 136,345,444 probably benign Het
Cd109 T C 9: 78,657,516 S248P probably benign Het
Cd28 A T 1: 60,765,283 H140L probably benign Het
Csmd3 G A 15: 48,673,407 T133I probably damaging Het
D430041D05Rik A T 2: 104,168,203 probably null Het
Defb47 T C 14: 63,000,993 V56A probably benign Het
Fxyd5 T C 7: 31,035,406 E132G probably damaging Het
H2-M2 A G 17: 37,483,213 V40A probably damaging Het
H2-Q7 T C 17: 35,440,176 L201P probably benign Het
Klra9 T G 6: 130,178,994 D266A probably damaging Het
Meioc A G 11: 102,675,034 N492S probably benign Het
Mgea5 T C 19: 45,776,045 probably null Het
Nmt2 A G 2: 3,316,178 E341G probably damaging Het
Nutm1 A C 2: 112,248,729 V947G possibly damaging Het
Pm20d1 G A 1: 131,798,596 G57D probably benign Het
Pnpla5 A G 15: 84,120,679 I157T probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sv2b A T 7: 75,140,109 I392N probably benign Het
Wfdc8 T A 2: 164,597,743 I240F probably benign Het
Other mutations in Olfr873
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02122:Olfr873 APN 9 20300584 missense probably damaging 1.00
IGL02268:Olfr873 APN 9 20300292 missense probably damaging 1.00
IGL02416:Olfr873 APN 9 20300245 missense probably benign 0.01
IGL03124:Olfr873 APN 9 20301163 missense probably benign 0.00
R0147:Olfr873 UTSW 9 20301091 missense probably damaging 1.00
R0148:Olfr873 UTSW 9 20301091 missense probably damaging 1.00
R0266:Olfr873 UTSW 9 20301158 missense probably benign 0.01
R0831:Olfr873 UTSW 9 20300565 missense probably benign 0.20
R1456:Olfr873 UTSW 9 20300838 missense probably benign 0.35
R1894:Olfr873 UTSW 9 20300337 missense probably benign 0.23
R1928:Olfr873 UTSW 9 20301058 missense probably benign 0.12
R2135:Olfr873 UTSW 9 20300297 missense probably benign 0.00
R2379:Olfr873 UTSW 9 20300667 missense possibly damaging 0.87
R2911:Olfr873 UTSW 9 20300479 missense possibly damaging 0.60
R3788:Olfr873 UTSW 9 20300370 missense probably benign 0.13
R4657:Olfr873 UTSW 9 20300623 missense probably damaging 1.00
R5754:Olfr873 UTSW 9 20301094 missense probably damaging 1.00
R6291:Olfr873 UTSW 9 20300603 missense probably damaging 1.00
R7014:Olfr873 UTSW 9 20300663 nonsense probably null
R7521:Olfr873 UTSW 9 20300740 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGTCTCAGAATTCCATCTCATGAG -3'
(R):5'- CACAGAGGCGAGGATTCATG -3'

Sequencing Primer
(F):5'- GAGAATCTCTGATGATCCAGAACTGC -3'
(R):5'- ATTCATGATGAGTGAGTAATGCAGTG -3'
Posted On2018-05-04