Incidental Mutation 'R6410:Meioc'
ID 514582
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms Gm1564, LOC380729, LOC268491
MMRRC Submission 044383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R6410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 102663716-102682237 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102675034 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 492 (N492S)
Ref Sequence ENSEMBL: ENSMUSP00000097947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect probably benign
Transcript: ENSMUST00000100378
AA Change: N492S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: N492S

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155813
Predicted Effect probably benign
Transcript: ENSMUST00000156590
AA Change: N436S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455
AA Change: N436S

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 C T 4: 133,062,899 R484W probably damaging Het
Arhgap24 T A 5: 102,892,151 I411N probably benign Het
Armt1 A G 10: 4,453,826 S304G probably benign Het
Atg9b T A 5: 24,386,110 N774I possibly damaging Het
C1s1 C T 6: 124,531,158 C624Y probably damaging Het
Camsap2 C A 1: 136,345,444 probably benign Het
Cd109 T C 9: 78,657,516 S248P probably benign Het
Cd28 A T 1: 60,765,283 H140L probably benign Het
Csmd3 G A 15: 48,673,407 T133I probably damaging Het
D430041D05Rik A T 2: 104,168,203 probably null Het
Defb47 T C 14: 63,000,993 V56A probably benign Het
Fxyd5 T C 7: 31,035,406 E132G probably damaging Het
H2-M2 A G 17: 37,483,213 V40A probably damaging Het
H2-Q7 T C 17: 35,440,176 L201P probably benign Het
Klra9 T G 6: 130,178,994 D266A probably damaging Het
Mgea5 T C 19: 45,776,045 probably null Het
Nmt2 A G 2: 3,316,178 E341G probably damaging Het
Nutm1 A C 2: 112,248,729 V947G possibly damaging Het
Olfr873 T A 9: 20,300,452 I84N probably damaging Het
Pm20d1 G A 1: 131,798,596 G57D probably benign Het
Pnpla5 A G 15: 84,120,679 I157T probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sv2b A T 7: 75,140,109 I392N probably benign Het
Wfdc8 T A 2: 164,597,743 I240F probably benign Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102674287 missense probably benign 0.33
IGL01952:Meioc APN 11 102672185 missense possibly damaging 0.79
IGL02006:Meioc APN 11 102674266 missense probably damaging 1.00
IGL02195:Meioc APN 11 102674857 missense possibly damaging 0.91
IGL02339:Meioc APN 11 102668448 missense probably benign 0.18
IGL02935:Meioc APN 11 102672191 missense probably benign 0.06
IGL03294:Meioc APN 11 102680669 missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102679957 missense probably damaging 1.00
R0285:Meioc UTSW 11 102672191 missense probably benign 0.06
R0964:Meioc UTSW 11 102680031 missense probably damaging 1.00
R1074:Meioc UTSW 11 102675393 missense probably damaging 1.00
R2024:Meioc UTSW 11 102675358 missense probably benign 0.00
R4012:Meioc UTSW 11 102675828 missense probably damaging 0.99
R4429:Meioc UTSW 11 102675720 missense probably damaging 1.00
R4491:Meioc UTSW 11 102674920 missense possibly damaging 0.84
R4594:Meioc UTSW 11 102674166 missense probably damaging 1.00
R4752:Meioc UTSW 11 102674433 missense probably benign 0.00
R5301:Meioc UTSW 11 102680045 missense probably damaging 1.00
R5352:Meioc UTSW 11 102675313 missense probably benign 0.03
R5646:Meioc UTSW 11 102675257 missense possibly damaging 0.94
R5958:Meioc UTSW 11 102675153 missense probably benign 0.41
R5968:Meioc UTSW 11 102675831 missense probably damaging 0.99
R6157:Meioc UTSW 11 102668401 missense probably damaging 1.00
R6644:Meioc UTSW 11 102668460 critical splice donor site probably null
R7285:Meioc UTSW 11 102666342 missense probably benign 0.00
R7440:Meioc UTSW 11 102674237 missense possibly damaging 0.67
R7815:Meioc UTSW 11 102675588 missense probably damaging 1.00
R7984:Meioc UTSW 11 102674606 missense possibly damaging 0.94
R8009:Meioc UTSW 11 102676743 missense probably damaging 1.00
R8078:Meioc UTSW 11 102668400 nonsense probably null
R8195:Meioc UTSW 11 102675067 nonsense probably null
R8429:Meioc UTSW 11 102674206 missense probably benign 0.06
R8797:Meioc UTSW 11 102676860 nonsense probably null
R8854:Meioc UTSW 11 102675763 missense probably damaging 0.98
R8891:Meioc UTSW 11 102668420 missense probably benign 0.43
R9081:Meioc UTSW 11 102674175 missense probably benign 0.00
R9360:Meioc UTSW 11 102674953 missense probably benign 0.13
Z1177:Meioc UTSW 11 102666364 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGCCTCACACAGCTTGTCC -3'
(R):5'- AGACTGAATTCTTTCTGCACCG -3'

Sequencing Primer
(F):5'- TCACACAGCTTGTCCAACTAATAATG -3'
(R):5'- TCTGCACCGTTGTAACTAAAATC -3'
Posted On 2018-05-04