Incidental Mutation 'R6410:H2-M2'
ID 514587
Institutional Source Beutler Lab
Gene Symbol H2-M2
Ensembl Gene ENSMUSG00000016283
Gene Name histocompatibility 2, M region locus 2
Synonyms Thy19.4, H-2M2
MMRRC Submission 044383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37480851-37483552 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37483213 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 40 (V40A)
Ref Sequence ENSEMBL: ENSMUSP00000131297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016427] [ENSMUST00000171139]
AlphaFold Q6W9L1
Predicted Effect probably damaging
Transcript: ENSMUST00000016427
AA Change: V40A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016427
Gene: ENSMUSG00000016283
AA Change: V40A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 29 207 1.6e-77 PFAM
IGc1 226 297 2.11e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171139
AA Change: V40A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131297
Gene: ENSMUSG00000016283
AA Change: V40A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 29 207 7.1e-76 PFAM
IGc1 226 297 2.11e-20 SMART
transmembrane domain 308 330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 C T 4: 133,062,899 R484W probably damaging Het
Arhgap24 T A 5: 102,892,151 I411N probably benign Het
Armt1 A G 10: 4,453,826 S304G probably benign Het
Atg9b T A 5: 24,386,110 N774I possibly damaging Het
C1s1 C T 6: 124,531,158 C624Y probably damaging Het
Camsap2 C A 1: 136,345,444 probably benign Het
Cd109 T C 9: 78,657,516 S248P probably benign Het
Cd28 A T 1: 60,765,283 H140L probably benign Het
Csmd3 G A 15: 48,673,407 T133I probably damaging Het
D430041D05Rik A T 2: 104,168,203 probably null Het
Defb47 T C 14: 63,000,993 V56A probably benign Het
Fxyd5 T C 7: 31,035,406 E132G probably damaging Het
H2-Q7 T C 17: 35,440,176 L201P probably benign Het
Klra9 T G 6: 130,178,994 D266A probably damaging Het
Meioc A G 11: 102,675,034 N492S probably benign Het
Mgea5 T C 19: 45,776,045 probably null Het
Nmt2 A G 2: 3,316,178 E341G probably damaging Het
Nutm1 A C 2: 112,248,729 V947G possibly damaging Het
Olfr873 T A 9: 20,300,452 I84N probably damaging Het
Pm20d1 G A 1: 131,798,596 G57D probably benign Het
Pnpla5 A G 15: 84,120,679 I157T probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sv2b A T 7: 75,140,109 I392N probably benign Het
Wfdc8 T A 2: 164,597,743 I240F probably benign Het
Other mutations in H2-M2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01683:H2-M2 APN 17 37481515 missense possibly damaging 0.95
Lock UTSW 17 37481508 missense probably damaging 1.00
Nokia UTSW 17 37481306 missense possibly damaging 0.59
R0799:H2-M2 UTSW 17 37482749 missense probably damaging 1.00
R0981:H2-M2 UTSW 17 37482630 missense probably benign 0.02
R1925:H2-M2 UTSW 17 37482500 missense probably damaging 0.98
R2959:H2-M2 UTSW 17 37483454 missense probably benign 0.20
R3968:H2-M2 UTSW 17 37481306 missense possibly damaging 0.59
R4063:H2-M2 UTSW 17 37481508 missense probably damaging 1.00
R4735:H2-M2 UTSW 17 37483244 missense possibly damaging 0.91
R5806:H2-M2 UTSW 17 37481726 missense probably damaging 1.00
R7432:H2-M2 UTSW 17 37481470 critical splice donor site probably null
R7456:H2-M2 UTSW 17 37481661 missense possibly damaging 0.60
R7535:H2-M2 UTSW 17 37482637 missense probably benign 0.07
R7680:H2-M2 UTSW 17 37483025 missense possibly damaging 0.56
R8112:H2-M2 UTSW 17 37483492 missense unknown
R8910:H2-M2 UTSW 17 37481522 missense probably damaging 1.00
R9034:H2-M2 UTSW 17 37481285 missense probably benign 0.05
R9193:H2-M2 UTSW 17 37482537 missense probably benign 0.00
R9420:H2-M2 UTSW 17 37481324 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCGCAGTTTCTGAAAGTACACTC -3'
(R):5'- AGAAGAGCACCTGGGAATCC -3'

Sequencing Primer
(F):5'- CTGAAAGTACACTCTAATCTGCTG -3'
(R):5'- GGGAATCCCACCCAGCCAG -3'
Posted On 2018-05-04