Incidental Mutation 'R6410:Mgea5'
ID514588
Institutional Source Beutler Lab
Gene Symbol Mgea5
Ensembl Gene ENSMUSG00000025220
Gene Namemeningioma expressed antigen 5 (hyaluronidase)
Synonyms2810009A20Rik, Hy5, 5830447M11Rik, 4833427O07Rik
MMRRC Submission 044383-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6410 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location45750261-45783520 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 45776045 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026243]
Predicted Effect probably null
Transcript: ENSMUST00000026243
SMART Domains Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAGidase 62 361 2.5e-84 PFAM
low complexity region 453 458 N/A INTRINSIC
PDB:4BMH|A 700 915 1e-13 PDB
SCOP:d1cjwa_ 715 916 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit perinatal lethality associated with a developmental delay and respiratory failure. Mouse embryonic fibroblasts exhibit proliferative and mitotic defects, frequent cytokinesis failure, and loss of genomic stability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 C T 4: 133,062,899 R484W probably damaging Het
Arhgap24 T A 5: 102,892,151 I411N probably benign Het
Armt1 A G 10: 4,453,826 S304G probably benign Het
Atg9b T A 5: 24,386,110 N774I possibly damaging Het
C1s1 C T 6: 124,531,158 C624Y probably damaging Het
Camsap2 C A 1: 136,345,444 probably benign Het
Cd109 T C 9: 78,657,516 S248P probably benign Het
Cd28 A T 1: 60,765,283 H140L probably benign Het
Csmd3 G A 15: 48,673,407 T133I probably damaging Het
D430041D05Rik A T 2: 104,168,203 probably null Het
Defb47 T C 14: 63,000,993 V56A probably benign Het
Fxyd5 T C 7: 31,035,406 E132G probably damaging Het
H2-M2 A G 17: 37,483,213 V40A probably damaging Het
H2-Q7 T C 17: 35,440,176 L201P probably benign Het
Klra9 T G 6: 130,178,994 D266A probably damaging Het
Meioc A G 11: 102,675,034 N492S probably benign Het
Nmt2 A G 2: 3,316,178 E341G probably damaging Het
Nutm1 A C 2: 112,248,729 V947G possibly damaging Het
Olfr873 T A 9: 20,300,452 I84N probably damaging Het
Pm20d1 G A 1: 131,798,596 G57D probably benign Het
Pnpla5 A G 15: 84,120,679 I157T probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sv2b A T 7: 75,140,109 I392N probably benign Het
Wfdc8 T A 2: 164,597,743 I240F probably benign Het
Other mutations in Mgea5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Mgea5 APN 19 45765540 missense possibly damaging 0.89
IGL01845:Mgea5 APN 19 45767862 missense probably benign 0.00
IGL02039:Mgea5 APN 19 45773703 missense probably damaging 0.98
IGL02428:Mgea5 APN 19 45765501 missense probably damaging 1.00
IGL02581:Mgea5 APN 19 45752191 missense possibly damaging 0.53
IGL02971:Mgea5 APN 19 45762243 missense probably damaging 1.00
R0127:Mgea5 UTSW 19 45771888 missense probably damaging 1.00
R0815:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R0863:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R1127:Mgea5 UTSW 19 45752155 nonsense probably null
R1501:Mgea5 UTSW 19 45778640 missense probably null 1.00
R1514:Mgea5 UTSW 19 45776931 missense probably damaging 1.00
R1586:Mgea5 UTSW 19 45776910 missense possibly damaging 0.94
R1716:Mgea5 UTSW 19 45752174 missense probably benign 0.35
R1755:Mgea5 UTSW 19 45758406 missense possibly damaging 0.93
R1774:Mgea5 UTSW 19 45776984 missense probably benign 0.37
R2152:Mgea5 UTSW 19 45758022 nonsense probably null
R4403:Mgea5 UTSW 19 45778639 missense probably damaging 1.00
R4664:Mgea5 UTSW 19 45771945 missense probably benign 0.15
R4971:Mgea5 UTSW 19 45770046 splice site probably null
R5377:Mgea5 UTSW 19 45758022 nonsense probably null
R5571:Mgea5 UTSW 19 45777006 missense probably benign
R5639:Mgea5 UTSW 19 45776999 missense probably damaging 1.00
R5665:Mgea5 UTSW 19 45776997 missense probably benign 0.00
R5776:Mgea5 UTSW 19 45771924 missense probably damaging 1.00
R6050:Mgea5 UTSW 19 45765480 missense possibly damaging 0.95
R6054:Mgea5 UTSW 19 45776132 missense probably damaging 1.00
R6317:Mgea5 UTSW 19 45771680 critical splice donor site probably null
R6990:Mgea5 UTSW 19 45767476 missense probably benign 0.00
R7103:Mgea5 UTSW 19 45783166 start gained probably benign
R7340:Mgea5 UTSW 19 45767456 nonsense probably null
R7422:Mgea5 UTSW 19 45776175 frame shift probably null
R7437:Mgea5 UTSW 19 45778607 missense possibly damaging 0.76
R7490:Mgea5 UTSW 19 45767447 nonsense probably null
R7741:Mgea5 UTSW 19 45776062 missense probably damaging 1.00
R7823:Mgea5 UTSW 19 45776915 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CACTGACAATGTCATGTTTACATACTT -3'
(R):5'- TCTCAGTTTGGGTGCAGGTC -3'

Sequencing Primer
(F):5'- AAACATCTCCAACTTACTTCTTTGG -3'
(R):5'- GCAGGTCGTTTGCTTTGC -3'
Posted On2018-05-04